Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064155 Similarity: 0.986 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA064155
Gene: MCAT_0
MFE: -29.
ENS: 0.990
Length: 75.
Predicted Ligands:
homocysteine - 6/20
fluoride - 5/20
SAM - 5/20
 RS: URS0000D8D335_1805027
MFE: -17.482
Ligand: fluoride
Species: Armatimonadetes bacterium CG2_30_59_28 Fluoride riboswitch
 RS: URS0000D900DF_342002
MFE: -26.342
Ligand: cobalamin
Species: Mycobacterium arupense Cobalamin riboswitch
 RS: URS0000AB86D1_710696
MFE: -27.445
Ligand: cobalamin
Species: Intrasporangium calvum DSM 43043 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064155 URS0000D8D335_1805027 URS0000D900DF_342002 URS0000AB86D1_710696
Length 75. 74. 76. 75.
Similarity - 0.986 0.986 0.985
Ensemble Norm 0.990 - - -
MFE -29. -17.482 -26.342 -27.445
Ligands - fluoride cobalamin cobalamin
Gene MCAT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 3.001 4.009
Length SE - 1. 1. 0.
Lev Distance - 17. 17. 19.
UBS 8. 7. 8. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 1. 1. 2. 2.
H 1. 1. 1. 1.
BL 4. 4. 3. 5.
BR 4. 5. 3. 5.
UN 0.120 0.122 0.145 0.027

Sequences

Field Description
UTR seq + 25 gcagucgggccucggucgccacgguaacgcgcgcgggcagguguccgaccATGAGCGTCCGGGTCGCACGGGTAG
UTR dot + 25 …((..((((.(((.(((((.(((..((.((((……)))).))))).)).))).)))))))..))……
RS 1 seq GGCGUCAAUGGCGAUGGAGUUCGCCCGUCCGAACAGACAAACGGCCUCUGAUGACUGAUGACUCCUGAUCCCGA
RS 1 dot ((.((((.(((((.(((((.(((…(((……)))…))).))))).)).))).)))).))………
RS 2 seq CAGGAAUCCGGUGCGAGUCCGGAGCGGUCCCGCCACUGUGAUCGGGCCAGUGCGCUCGCCCGAGAGUCAGAUACUG
RS 2 dot …((.(((((.(((((..((.(..((((((((….)))…)))))..).)))))))))).)).))……..
RS 3 seq ACCAGGAACCCGGUGCGAGCCCGGGACGGUCCCGCCACUGUGAGCGCGCCCUCCGGGGCCGUGAGUCAGGAACUG
RS 3 dot ..(((…((.((.(((.((((.(((.(((..(((((…)).))).))).))).)))))))…)).))..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table