Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064211 Similarity: 0.973 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA064211
Gene: MCHR2
MFE: -25.119
ENS: 0.736
Length: 112.
Predicted Ligands:
TPP - 17/20
SAM - 1/20
glycine - 1/20
 RS: URS0000C3CFF3_1460639
MFE: -25.381
Ligand: SAM
Species: Bacillus sp. JCM 19045 SAM riboswitch (S box leader)
 RS: URS0000D93797_114686
MFE: -48.170
Ligand: TPP
Species: Streptomyces phaeoluteigriseus TPP riboswitch (THI element)
 RS: URS0000DB2BFB_42322
MFE: -22.195
Ligand: TPP
Species: Eubacterium ruminantium TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064211 URS0000C3CFF3_1460639 URS0000D93797_114686 URS0000DB2BFB_42322
Length 112. 111. 112. 111.
Similarity - 0.973 0.973 0.972
Ensemble Norm 0.736 - - -
MFE -25.119 -25.381 -48.170 -22.195
Ligands - SAM TPP TPP
Gene MCHR2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 18.010 5.001 2.005
Length SE - 1. 0. 1.
Lev Distance - 28. 35. 36.
UBS 8. 5. 9. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 1. 1. 1. 1.
H 3. 3. 3. 3.
BL 3. 1. 3. 2.
BR 2. 0. 4. 2.
UN 0.098 0.198 0.125 0.171

Sequences

Field Description
UTR seq + 25 cccacgcuccuagaaaagagcacgacgcacccgaugcucggauuggaugaaguggcaaagcuuuaaucccuggaaaguccacgaacaATGAATCCATTTCATGCATCTTGTT
UTR dot + 25 …..((((……..)))).(((.(((…..))))))((.((.(((((((((………..((..((((…)))).))………))))))))).))))…..
RS 1 seq CUUUUAUCCAGAGAUGGUGGAGGGACAGGCCCGAAGAAACCCAGCAACCAACACGUCAUGUGGAAAGGUGCUAACCUGCAGAAUCUUUUUAAUGGUUCUGGGAGAUAAGAG
RS 1 dot ……((((…….))))(((…..)))…….(((((.(((((……………((((….))))……………))))))))))………
RS 2 seq UAGAGCACUCGCGGGAGCCCGGACGCACCGGGCUGAGAGGGAGGCUGGCGGCCUCCGACCGUACGAACCUGAUCCGGGUCAUGCCGGCGAAGGGAGGGGCUGGACUCCCAUG
RS 2 dot ….((….))…(((((((…..)))))))….(((((.(((((..(((((..(((((.(.(((((…)))))).))).))…..))))).))))).)))))…
RS 3 seq AACUUGAUGCAGGGGAGUUUGUUUAAACAAUCUGAGAGGAAGCUGGUAUCGCUUCGACCCUAUAACCUGAUACGGGUAAUUCCGGCGCAGGGAGUCAUACUGGUGGAUUAU
RS 3 dot ..((((…))))..((.((((….)))).))……..((((((((.((((………..((((…((((….))))…)))))))).))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table