Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064227 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA064227
Gene: MCM2
MFE: -21.093
ENS: 0.815
Length: 82.
Predicted Ligands:
zmp-ztp - 6/20
cobalamin - 5/20
homocysteine - 5/20
RS: URS0000D9A8B3_1906740
MFE: -34.747
Ligand: cobalamin
Species: Streptomyces sp. CC53 Cobalamin riboswitch
RS: URS0000AB584E_396595
MFE: -27.945
Ligand: homocysteine
Species: Thioalkalivibrio sp. K90mix S-adenosyl-L-homocysteine riboswitch
RS: URS0000C6D68B_1736373
MFE: -19.157
Ligand: homocysteine
Species: Methylophilus sp. Leaf416 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064227 URS0000D9A8B3_1906740 URS0000AB584E_396595 URS0000C6D68B_1736373
Length 82. 83. 82. 82.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.815 - - -
MFE -21.093 -34.747 -27.945 -19.157
Ligands - cobalamin homocysteine homocysteine
Gene MCM2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 2. 6.001
Length SE - 1. 0. 0.
Lev Distance - 19. 22. 21.
UBS 8. 7. 8. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 2.
ILR 2. 3. 1. 2.
H 2. 2. 2. 2.
BL 2. 1. 2. 4.
BR 2. 2. 2. 1.
UN 0.073 0.145 0.061 0.098

Sequences

Field Description
UTR seq + 25 acuuuucgcgcgaaaccugguuguugcuguaguggcggagaggaucgugguacugcuATGGCGGAATCATCGGAATCCTTCA
UTR dot + 25 .((((((((.((..((..(((….)))))..))))))))))(((((((((.((((….)))).)))).))..)))…..
RS 1 seq AGAGGAAGCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUCACCGGCCCGCCCCUUCCGGACGCGGCCGGGAGCCAGGAACUC
RS 1 dot …….((((((((.(….((((……))))..).))))))))(((((((..(((….)))..))).))..))…..
RS 2 seq CCGGCUGAGGAGCGCUGCAGCGGUUUAACCGUCAGGCUCAGCCGGAUGUCCCCCUGAAACGUGAACACGGCGCUCAUCCAGA
RS 2 dot ..((((…((((.(((..(((((…))))))))))))))))(((((..(((.((………)).)).)..)))))…
RS 3 seq CCUUCUGAGGAACGCUGCGAGAGUUUCAUACUCCCAGGCUCAGAGUGAUAGCUGCGAAGCUUCUCAACUGCGUUCACUUUUC
RS 3 dot ….(((((…(.(((.(.((((…..))))))))))))))(((((..((((.((….)).))…))..)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table