Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064232 Similarity: 0.972 Similarity: 0.971 Similarity: 0.969
UTR: 5HSAA064232
Gene: MCM3
MFE: -50.214
ENS: 0.848
Length: 135.
Predicted Ligands:
molybdenum - 19/20
cobalamin - 1/20

 RS: URS0000ABC775_419109
MFE: -38.589
Ligand: molybdenum
Species: Vibrio parahaemolyticus AQ3810 Moco (molybdenum cofactor) riboswitch
 RS: URS0000DB654D_1926881
MFE: -46.736
Ligand: molybdenum
Species: Izhakiella australiensis Moco (molybdenum cofactor) riboswitch
 RS: URS0000AB5131_223926
MFE: -36.839
Ligand: molybdenum
Species: Vibrio parahaemolyticus RIMD 2210633 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064232 URS0000ABC775_419109 URS0000DB654D_1926881 URS0000AB5131_223926
Length 135. 134. 135. 134.
Similarity - 0.972 0.971 0.969
Ensemble Norm 0.848 - - -
MFE -50.214 -38.589 -46.736 -36.839
Ligands - molybdenum molybdenum molybdenum
Gene MCM3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 19. 3.
Length SE - 1. 0. 1.
Lev Distance - 35. 32. 39.
UBS 8. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 3. 1.
ILR 0. 1. 3. 1.
H 5. 5. 5. 5.
BL 2. 1. 0. 1.
BR 2. 2. 1. 1.
UN 0.111 0.104 0.133 0.104

Sequences

Field Description
UTR seq + 25 cucgagguaaccuuugguggcgggaagaguucggaaguuuucgcgccgggguggagucauccugggaaccuccacgcgacuuugguggagguaguucuuuggcagcgggcATGCTTATATGCTCCCAAGGTCCCC
UTR dot + 25 .((((((….))))))…((.(((((.((…)).))))).))((((((((….))))))))..((((((((………))))))))….((((((….(((((((….)))))))))))))…..
RS 1 seq UGGUUGCCAUAACUCCGAGCUCACUAUGCUAAGUCUGAGGAUAAGCAUUUUGAGCCAGUGACAUACUGUCACAAGGGCAUGAUUGGAAAUGGCCAUGCCUCCCGUGUUUGGAAAGGUGUUCCGUGGCGCAACAA
RS 1 dot .(((((…)))))..(.(((((..(((((..(((….))).)))))..)))))).((((((…))))))..(((((((…………)))))))…((((((((((…..))))).)))))…..
RS 2 seq CGGGUGUGAUGACACUUAAGCCUUGAUACCUACGUCCAACGGAUAGGGUGUCCUGGCCGCAACCUGAGGUUGCCAGGGUGCAGGAAGAAAUGACUGCAUCUCCCGAUACUGGAAAGGUGUUCCUUUUGCCACAAU
RS 2 dot .((((((….))))))..(((..(((((((..(((…..))).)))))))..))).((((((…))))))..((((((((..(….)..))))))))……..((((((((….)))))..)))….
RS 3 seq UGGUUGCCAUAACUCCGAGCUCACUAUGCUAAGUCCGAGGAUAAGCAUUUUGAGCCAGUGACAUACUGUCACAAGGGCAUGAUUGGAAAUGGCCAUGCCUCCCGUGUUUGGAAAGGUGUUCCGUGGCGCAACAA
RS 3 dot .(((((…)))))..(.(((((..(((((………….)))))..)))))).((((((…))))))..(((((((…………)))))))…((((((((((…..))))).)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table