Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064252 Similarity: 0.986 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA064252
Gene: MCM3AP
MFE: -3.166
ENS: 0.911
Length: 61.
Predicted Ligands:
fluoride - 10/20
unknown - 6/20
cobalamin - 4/20
 RS: URS0000E60499_1523413
MFE: -28.579
Ligand: unknown
Species: Novosphingobium sp. AAP1 nhaA-I RNA
 RS: URS0000BF26FF_268407
MFE: -18.783
Ligand: fluoride
Species: Paenibacillus wynnii Fluoride riboswitch
 RS: URS0000BF30EF_869279
MFE: -14.772
Ligand: fluoride
Species: Thermanaerothrix daxensis Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064252 URS0000E60499_1523413 URS0000BF26FF_268407 URS0000BF30EF_869279
Length 61. 60. 62. 61.
Similarity - 0.986 0.985 0.985
Ensemble Norm 0.911 - - -
MFE -3.166 -28.579 -18.783 -14.772
Ligands - unknown fluoride fluoride
Gene MCM3AP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.077 2.023 3.053
Length SE - 1. 1. 0.
Lev Distance - 17. 19. 20.
UBS 4. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 0. 1. 1.
H 1. 1. 2. 2.
BL 1. 2. 1. 0.
BR 2. 3. 2. 2.
UN 0.393 0.117 0.242 0.164

Sequences

Field Description
UTR seq + 25 uaauacuuaauuaccuucuaauaauuggagcagaagATGAACCCAACTAATCCTTTCAGTG
UTR dot + 25 …………………..(((((((..((((.((….)).))..)).))))))).
RS 1 seq GGGUGCUCGCUGGCCAGAACGUGGUGCGGGCAGGCUUUUGCGCUGGUCGGGCCGCCAGCG
RS 1 dot …….(((((((……..(((.(((.(((((….)).))).))).))))))))))
RS 2 seq AGUUGAUAAGGCGAUGGAGUUCGCCAAAACCGCCGGUAACGGCUAAUGACUCCUACCAGCGA
RS 2 dot ………(((((……)))))…..(((.((((..(((….).))..)))).))).
RS 3 seq AUACUUGGUGGCGAUGAGGCUCGCCGUAAGUGUCGGUAUGACUAAUAGCCUCUACUUGAAC
RS 3 dot ……((((((……)).)))).((((((..(((((…..))).))..))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table