Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064268 Similarity: 0.979 Similarity: 0.979 Similarity: 0.977
UTR: 5HSAA064268
Gene: MCM4
MFE: -36.987
ENS: 0.898
Length: 102.
Predicted Ligands:
purine - 7/20
glycine - 5/20
TPP - 4/20
 RS: URS0000D7DB35_1834191
MFE: -22.406
Ligand: tetrahydrofolate
Species: Enterococcus sp. 8G7_MSG3316 THF riboswitch
 RS: URS0000C36B12_1418104
MFE: -12.816
Ligand: purine
Species: Clostridium argentinense CDC 2741 Purine riboswitch
 RS: URS0000C742F0_1221500
MFE: -19.581
Ligand: purine
Species: Fictibacillus phosphorivorans Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064268 URS0000D7DB35_1834191 URS0000C36B12_1418104 URS0000C742F0_1221500
Length 102. 102. 102. 102.
Similarity - 0.979 0.979 0.977
Ensemble Norm 0.898 - - -
MFE -36.987 -22.406 -12.816 -19.581
Ligands - tetrahydrofolate purine purine
Gene MCM4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 19.010 12.
Length SE - 0. 0. 0.
Lev Distance - 27. 21. 26.
UBS 9. 8. 6. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 3.
ILR 3. 4. 1. 4.
H 2. 2. 1. 1.
BL 3. 3. 3. 2.
BR 1. 2. 3. 3.
UN 0.078 0.049 0.176 0.078

Sequences

Field Description
UTR seq + 25 gcgcuacucgccagguggacucggaguccgcgagcgucgucggcaagcggccgccuuuccacgguacuccgagcacuATGTCGTCCCCGGCGTCGACCCCGA
UTR dot + 25 ……..((((.((.((((((((((((((.(((((..((((…..)))))))…))..))).)))))))……….))))))))))(((….)))
RS 1 seq AUCAGAGUAGGAAAUAGAACGUUUAGUGCUGAGAGGAUGGGAUAUUGCCUUUCUGACAAAGGACAAUUAGAUGUUCGCGGUUUUAUUUUCGCAUUCGCUGCA
RS 1 dot …(((((((((….(((((((((((.((..(.(((.(((……))).)))..)..)).))…)))))))))….))))))))).(((…..))).
RS 2 seq UUUUUUAAAAUAUUAGUGGCUCAUAUAAGUUUAAUGAUAGGGAUUAAAUGUUUCUACUUGGUAACCUUGAAUUACCAGACUAUGGGUUUUAAUAAACUUGAA
RS 2 dot ……….((((((.((((((((((((.(((.((((((((((…..))))))).))).))).))))………..))))))))))))))……..
RS 3 seq GUGUCAGAUAAUAUUCUCCUUCGUAUAUCCUCGAUAAUAAGGUUCGAGAGUCUCUACCGGGUUGCCGAAAAUGACCUGACUAUGAAGGCAGGAUUCUUUAUA
RS 3 dot …….((((.((((((((((((((((..(((.((((..(((..(((…))).)))..)))).)))..)))…….)))))))).)))))…)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table