Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064272 Similarity: 0.961 Similarity: 0.960 Similarity: 0.956
UTR: 5HSAA064272
Gene: MCM4_0
MFE: -65.397
ENS: 0.885
Length: 156.
Predicted Ligands:
TPP - 7/20
FMN - 3/20
Mg2+ - 3/20
 RS: URS0000AB8A85_641107
MFE: -35.319
Ligand: glycine
Species: Clostridium sp. DL-VIII Glycine riboswitch
 RS: URS0000AB2442_229533
MFE: -48.253
Ligand: TPP
Species: Gibberella zeae PH-1 TPP riboswitch (THI element)
 RS: URS0000AB8F7F_406818
MFE: -39.822
Ligand: molybdenum
Species: Xenorhabdus bovienii SS-2004 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064272 URS0000AB8A85_641107 URS0000AB2442_229533 URS0000AB8F7F_406818
Length 156. 156. 156. 157.
Similarity - 0.961 0.960 0.956
Ensemble Norm 0.885 - - -
MFE -65.397 -35.319 -48.253 -39.822
Ligands - glycine TPP molybdenum
Gene MCM4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.006 7.005 7.
Length SE - 0. 0. 1.
Lev Distance - 48. 51. 54.
UBS 12. 11. 12. 12.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 5.
ILR 1. 3. 2. 2.
H 4. 3. 3. 3.
BL 3. 4. 2. 4.
BR 3. 3. 5. 3.
UN 0.077 0.154 0.147 0.070

Sequences

Field Description
UTR seq + 25 aggggcggagacgaccuugccgccggcgggaacucugggucucgcgguuugggagcgcuacucgccagguggacucggaguccgcgagcgucgucggcaagcggccgccuuuccacgguacuccgagcacuATGTCGTCCCCGGCGTCGACCCCGA
UTR dot + 25 .(((((((…((..(((((((.(((((((.((((((((((.(((…(((((((…..))).)))))))))))))))))))…..))))).))))))))).)))))))….(((….)))……((((((….))))))((….)).
RS 1 seq GGAUGAACCCUUGGAGAGACUCUUAGAGGCAGAAUAAGAAAUAACAAAUCAGUAUGUUUUCAUAUUGAGCCCAUUAUUUUUUAUGUGCUAAAAUAGAGCACCGAAGGAGAAAGCUUAAAAGGCGAAACUCUCAGGUAAAAGGACAGGGGAAAGAUA
RS 1 dot ……..((((.(.(.(.((((….((((..(((((((((((….((((((((….))))))))…..))))))))))).))))…..))))).)).))))…..((((…))))…..((((..((……))..))))……
RS 2 seq AAGAACGCAUCCGGGUGUUCAACUGCCUCUAUGCUCUGUGCCACAACCUCAGCUAUCAAAAGCUUGAGGACGACCAGAGCAGGGCGGUUGAUCUGAGAAAUACCGGCGAACUUGAUCUGGAUAAUACCAGCGAAAGGACAUGCUUCUUGACAUCCC
RS 2 dot ………(((.(((((((((((((((…(((((((.(…(..((((((((……)))).))))..).))))))))))))))))))……..))))).).))…….((((……))))((((((……))).)))…….
RS 3 seq AAUUGGUAUUAACUCCUAGCCUCUGUGUCUAAGUCAUUGUUCUAUCAUACGGAUACCACAUUGAGAUGAUGCUUUGGCCGUGGCUCCUGAGUCACCAGGGUGCAAGGUAGAAAUGCCUGCAUCUCCCGCAUUUGGAAGGUGUUAUUGUGGAACAACU
RS 3 dot ..(((((….((((..((((..((.(((.(((.(((((((…(((…((…))….))))))))))))).))))).))))…)))).)))))(((((.(((((….))))))))))..(((((……………)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table