Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064407 Similarity: 0.985 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA064407
Gene: MDH1B
MFE: -23.023
ENS: 0.
Length: 80.
Predicted Ligands:
cobalamin - 6/20
SAM - 6/20
zmp-ztp - 2/20
 RS: URS0002315521_198822
MFE: -31.549
Ligand: cobalamin
Species: Candidatus Burkholderia kirkii Cobalamin riboswitch
 RS: URS000232DF84_12908
MFE: -20.849
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000C65629_12908
MFE: -25.333
Ligand: zmp-ztp
Species: unclassified sequences ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064407 URS0002315521_198822 URS000232DF84_12908 URS0000C65629_12908
Length 80. 79. 81. 80.
Similarity - 0.985 0.984 0.984
Ensemble Norm 0. - - -
MFE -23.023 -31.549 -20.849 -25.333
Ligands - cobalamin cobalamin zmp-ztp
Gene MDH1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 5.003 11.004
Length SE - 1. 1. 0.
Lev Distance - 17. 18. 17.
UBS 8. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 0.
ILR 1. 1. 0. 0.
H 2. 2. 2. 2.
BL 2. 4. 4. 4.
BR 4. 3. 4. 5.
UN 0.138 0.127 0.086 0.

Sequences

Field Description
UTR seq + 25 gugguugccaggaaaccgcgaagccgcggucccugccucugagucucucucgaccATGACGACTGAACTGATGATGGTAA
UTR dot + 25 ……..((((..((((((….)))))).))))(((((.(((.((..(((…….)))..))))).).)).))…
RS 1 seq GGAAGCCGGUGCGAACCCGGCACGGUCGCGCCACUGUGAGCGGUUCGUCAGCGAAGGAGCGAGGCGCCGCAAGUCAGAC
RS 1 dot …….((((((.(((……))))))))).((((..(((((.(.((.((……)))).).)))))..).)))..
RS 2 seq GUACUGAAAUGCAUGGUGGGAAAUCAGUGUGUAAUUCAUUGGCUGUGCCUGCAACCGUAAAGUCGGAGCGCCACCCAGUAU
RS 2 dot …..(((.((((((.(((….))).)))))).)))(((((.((.((..((..(((……))).)))))).)))))..
RS 3 seq UCGUCACCAUGUGACUGGCGUUUUAGACAGGUCACUGUCGGGGAGCAUGGUUGCCGCCGCCGCGCGCCUGGGCAUCACUU
RS 3 dot ……….((((((.((……).).))))))((((.(((.((.((((…….)))).)).))).))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table