Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064807 Similarity: 0.971 Similarity: 0.968 Similarity: 0.968
UTR: 5HSAA064807
Gene: MED24
MFE: -28.787
ENS: 0.719
Length: 129.
Predicted Ligands:
TPP - 8/20
SAM - 8/20
cobalamin - 3/20
 RS: URS0000D95C87_2017
MFE: -59.130
Ligand: cobalamin
Species: Streptoalloteichus hindustanus Cobalamin riboswitch
 RS: URS0000D8B346_1797900
MFE: -47.162
Ligand: TPP
Species: Deltaproteobacteria bacterium RIFOXYB2_FULL_66_7 TPP riboswitch (THI element)
 RS: URS0000D7CDC3_1798317
MFE: -39.022
Ligand: TPP
Species: Geobacteraceae bacterium GWC2_55_20 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064807 URS0000D95C87_2017 URS0000D8B346_1797900 URS0000D7CDC3_1798317
Length 129. 128. 127. 127.
Similarity - 0.971 0.968 0.968
Ensemble Norm 0.719 - - -
MFE -28.787 -59.130 -47.162 -39.022
Ligands - cobalamin TPP TPP
Gene MED24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 10.003 10.004
Length SE - 1. 4. 4.
Lev Distance - 36. 33. 34.
UBS 11. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 4. 3. 2. 3.
ILR 3. 3. 4. 1.
H 3. 3. 3. 4.
BL 1. 1. 2. 1.
BR 2. 2. 2. 2.
UN 0.132 0.148 0.189 0.197

Sequences

Field Description
UTR seq + 25 aauagaaagugagcuucuugacaagugccaaaauggcgaugccuaccaccuagaacuggauugugcgcuggccgccaccgcugccaccugcucagagugaaauaATGAAGGTGGTCAACCTGAAGCAAG
UTR dot + 25 ………((.((..(((…))).))))…(((((..(((..(((((((….)))…))).)..))))))))..((((((((((..(((………..))))))))))……..)))…
RS 1 seq GAGGAAGCCGGUGCGAGUCCGGCGCGGUCCCGCCACUGUGACCGGGGAGCGAUCCUCCCGAGUGCGCCACCGGGGCCAAGGCCCCGGGAAGGCCGGAGGGGAGCGGUGAUCCGGGAGCCAGGACACUC
RS 1 dot ……(((((…….)))))..(((((((…..(((((..(((((…..)))))..)).)))…)))))))..((((((.(((..((((……..))))..)))))).)))………
RS 2 seq AGAUACCGCCAGGGGUGCAUUUCGCUGAGAGCUCCGGGGGAACGCACCGCGUGCGCCUUCCCCUUCGGGCAACCCGUCGAACCUGACCCGGGUAAUGCCGGCGCAGGGAGCGUGGUCCUCUUCGAAC
RS 2 dot ………(((.((……)).)))…((((.((((((((((((…)))))..)))))))..)))).((((((….((((..((((……))))..))))..))).)))………..
RS 3 seq AUAAGGCCCUGGGGGAGUUCAUUGGAACUGAGAUCCGACUGCCGUGGACAUGUCAUGUUCGCACAGCGGGAACCCUUUGUACCUGAACCGGGUAAUUCCGGCGUAGGAAAGCGGCUUACAGGAUAUA
RS 3 dot ……(((…)))(((((….)))))….((((.(((..((((((((…)))))))).)))))))..((((((…((((..(((((….)))))..)))))))).))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table