Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064824 Similarity: 0.967 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA064824
Gene: MED24_0
MFE: -38.622
ENS: 1.
Length: 129.
Predicted Ligands:
cobalamin - 12/20
FMN - 2/20
TPP - 2/20
 RS: URS0000ABC227_12908
MFE: -25.597
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000C0EDFB_1395513
MFE: -25.550
Ligand: cobalamin
Species: Sporolactobacillus laevolacticus DSM 442 AdoCbl riboswitch
 RS: URS0000C60554_864051
MFE: -69.985
Ligand: zmp-ztp
Species: Burkholderiales bacterium JOSHI_001 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064824 URS0000ABC227_12908 URS0000C0EDFB_1395513 URS0000C60554_864051
Length 129. 128. 129. 130.
Similarity - 0.967 0.966 0.966
Ensemble Norm 1. - - -
MFE -38.622 -25.597 -25.550 -69.985
Ligands - cobalamin cobalamin zmp-ztp
Gene MED24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.009 27.003 2.003
Length SE - 1. 0. 1.
Lev Distance - 42. 33. 44.
UBS 10. 10. 7. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 1. 3.
ILR 1. 2. 3. 1.
H 3. 2. 2. 3.
BL 3. 4. 3. 2.
BR 5. 6. 2. 4.
UN 0.178 0.086 0.233 0.123

Sequences

Field Description
UTR seq + 25 accuacuaacuaggggcuaacgaaugaaagggugucggaauaugauggagaagcccggucgacagugacgucgugggcgacgccggguugugagcggccuuucgATGAAGGTGGTCAACCTGAAGCAAG
UTR dot + 25 .((((…..))))……….(((((((.(((((.(((….(((.(..(((((..((((……)))))))))..).))).))).))).)).)))))))….((((…..))))……..
RS 1 seq UAGCUGAAAGUUGGUGGGAAAUCAGUGUGAAAUUCAUUGGCUGUGCCUGCAACCGUAAAGUCGGAGCGCCACCCAGCUAAGUCCGCUGUGAAUGAGGGCCAGGGAAAGUCUAGUUCUACAAUGAAAAA
RS 1 dot ..(((((…………..)))))……((((((((((.(.((((…((.(….(((.((((..((……..)).)))).)))…).)).)))).).)))………)))))))…
RS 2 seq AAGUCAAAAUGUACGUGCUAAUUAGAUGGAAACAGGUGAAAGUCCUGUACGGUCCCGCCACUGUAAGGGAGAAAUCCUAAGUCAGGUCUUUCUAAUUAGUUAAAUACUCACGAGGUAUGGGGGAGAGUU
RS 2 dot …………….((((((((((.(((.(((((……((((.((((((……)))))).))))…..)))..))….))).))))))))))…(((((…..)))))………..
RS 3 seq CAAUCUUCGCGCGACUGGCGAUAAGGGCCUGCCCGGACACCCGGCAGGCCCCAGGUGGAACACCACCGGGGAGCGCGGGCCAGGGCGGGCCAUCCAGCCCUGGCGUCAGCCGUUCGCCUGGGCAGCCCUG
RS 3 dot ….(((..(((…..)))..)))(((((((((((…((((((…((((.(((((….))))))))).)).)))))).)))))))))…..((((.((((………)))).))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table