Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064827 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA064827
Gene: MED24_1
MFE: -27.037
ENS: 0.749
Length: 113.
Predicted Ligands:
SAM - 19/20
GMP - 1/20

 RS: URS0000C2411E_574376
MFE: -24.689
Ligand: SAM
Species: Bacillus sp. BL4-6 SAM riboswitch (S box leader)
 RS: URS0000C1DD31_1590652
MFE: -32.539
Ligand: SAM
Species: Cohnella kolymensis SAM riboswitch (S box leader)
 RS: URS0000C755BB_586416
MFE: -35.589
Ligand: SAM
Species: Terribacillus aidingensis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064827 URS0000C2411E_574376 URS0000C1DD31_1590652 URS0000C755BB_586416
Length 113. 113. 113. 112.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.749 - - -
MFE -27.037 -24.689 -32.539 -35.589
Ligands - SAM SAM SAM
Gene MED24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.015 2.005 6.005
Length SE - 0. 0. 1.
Lev Distance - 33. 35. 32.
UBS 10. 8. 9. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 3.
ILR 3. 3. 3. 3.
H 3. 3. 3. 3.
BL 1. 1. 1. 2.
BR 2. 1. 2. 1.
UN 0.150 0.274 0.221 0.223

Sequences

Field Description
UTR seq + 25 aauagaaagugagcuucuugacaagugccaaaauggcgaugccuaccaccuagaacuggauugugcgcuggccgccaccgcugccaccATGAAGGTGGTCAACCTGAAGCAAG
UTR dot + 25 ………((.((..(((…))).))))…(((((..(((..(((((((….)))…))).)..))))))))..(((((((((…..))))))……..)))…
RS 1 seq UUCUUAUCUAGAGAGGUCUAGGGACUGGCCCGUUGACGCCUCAGCAACCAUUAACAUUUUUGUUAAUAAGGUGCUAAUUCCAGCAAACUGAGAAAUGAUUUGAAAGAUAAGAA
RS 1 dot ……….(((..(((..(((…..)))…)))..)))(((.((((((((((….)))))))..))))))..((((((….))).)))……………….
RS 2 seq AUCUUAUCAAGAGCAGGCGGAGGGACUAGCCCGAUGAAGCCCGGCAACCGGCGUGUAUCAGCAACGCACGGUGCUAAUUCUUGCGGAAACGUAAAGUUUCUGACAGAUGAGAG
RS 2 dot ……………((((..(((…..)))..)…))).(((.((((((((((….))).))).)))))))…(((..(((((((…..)))))))..)))……
RS 3 seq AUCUUAUAACGAGUGGUGGAGGGAAAGGCCCGAUGAAGCCCGGCAACCCACUGCAGGAGGGCAGUCCUGCAGGAAGGUGCUACGACCUGCAGCAAAAGCUGCGUGAUAAGAU
RS 3 dot ………((.((..((..(((…..)))..))..)).))((.(((..((((((((……))))))))…)))))…….((((((….))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table