Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064828 Similarity: 0.976 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA064828
Gene: MED24_2
MFE: -37.132
ENS: 0.976
Length: 113.
Predicted Ligands:
TPP - 5/20
glycine - 5/20
SAM - 4/20
 RS: URS0000D6792D_12908
MFE: -39.381
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000BEC403_197221
MFE: -33.051
Ligand: glutamine
Species: Thermosynechococcus elongatus BP-1 Glutamine riboswitch
 RS: URS0000D7BA09_1121400
MFE: -32.129
Ligand: TPP
Species: Desulfobacterium vacuolatum DSM 3385 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064828 URS0000D6792D_12908 URS0000BEC403_197221 URS0000D7BA09_1121400
Length 113. 114. 113. 113.
Similarity - 0.976 0.973 0.973
Ensemble Norm 0.976 - - -
MFE -37.132 -39.381 -33.051 -32.129
Ligands - GMP glutamine TPP
Gene MED24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.011 7. 26.011
Length SE - 1. 0. 0.
Lev Distance - 29. 34. 27.
UBS 7. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 3.
ILR 0. 1. 2. 4.
H 2. 1. 2. 2.
BL 3. 2. 2. 1.
BR 3. 3. 2. 1.
UN 0.204 0.096 0.186 0.097

Sequences

Field Description
UTR seq + 25 aaauuuggggaggugguggaugaaaaggaaauugggaggugcgguaggcuucuggccgccaccgcugccaccugcucagagugaaauaATGAAGGTGGTCAACCTGAAGCAAG
UTR dot + 25 …((((((.(((((((((………….(((..((((.(.(((….))).))))).)))))))))))).))))))…………((((…..))))……..
RS 1 seq CGUAACGAGCGCGGCUGUGACUUCGGGACGAAAUCGGUCACCACGCCUUCGCGGCUCUUGAGUCUGCGAGGCGUCACCCGAAGUAGCCAAUGGUGAGACCGGCGCCCGGGAACG
RS 1 dot …..((.((((((((…((((((((..((…………((((.((((((((….)).)))))))))))).))))))))))))………….)))).))……
RS 2 seq AUCGUUCAUCCCUCGUAGGACCUCAGUAAACGCUUUUCAGACCGAGUUGAAGUGUCAGCGUUGUUCCUUUGCGAGGGACGGAAGUAGGGAAAUAAAUCCCGAAGGAACGCGCC
RS 2 dot ….(((.((((((((((((.(……((((((((((((……))))))….))))))).))))..)))))))).)))….((((……))))………….
RS 3 seq AUGGCAGACUGGGGGAGCCGGUGAAAGUCGGCUGAGAGGAGGCUUAGUUUGUGCCUCGACUCCUGGAACCUGAUCCAGUUAAUUCUGGCGAAGGAAAGUCCUUUUUUUAUUUU
RS 3 dot ..(.(((((((((((..((((…………(((..(((((………)))))..)))))))..)))…))))…..)))).)((((((…))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table