Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064831 Similarity: 0.966 Similarity: 0.966 Similarity: 0.963
UTR: 5HSAA064831
Gene: MED24_3
MFE: -43.169
ENS: 0.984
Length: 135.
Predicted Ligands:
cobalamin - 7/20
FMN - 5/20
TPP - 4/20
 RS: URS0000AB6DF3_1302244
MFE: -48.277
Ligand: FMN
Species: Propionibacterium acnes JCM 18920 FMN riboswitch (RFN element)
 RS: URS0000D94F09_1868284
MFE: -29.769
Ligand: TPP
Species: Endozoicomonas sp. (ex Bugula neritina AB1) TPP riboswitch (THI element)
 RS: URS0000C106DE_1746199
MFE: -54.678
Ligand: glycine
Species: Bordetella sp. N Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064831 URS0000AB6DF3_1302244 URS0000D94F09_1868284 URS0000C106DE_1746199
Length 135. 135. 133. 134.
Similarity - 0.966 0.966 0.963
Ensemble Norm 0.984 - - -
MFE -43.169 -48.277 -29.769 -54.678
Ligands - FMN TPP glycine
Gene MED24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.011 2.002 7.004
Length SE - 0. 4. 1.
Lev Distance - 44. 40. 46.
UBS 10. 11. 10. 11.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 2.
ILR 1. 2. 0. 3.
H 3. 3. 3. 3.
BL 4. 3. 4. 5.
BR 3. 3. 4. 3.
UN 0.156 0.052 0.113 0.090

Sequences

Field Description
UTR seq + 25 aaauuuggggaggugguggaugaaaaggaaauugggaggugcgguaggcuucuggccgccaccgcugccaccugcucagagugaaauaaugaagguggucaaccugaagcATGAAGGTGGTCAACCTGAAGCAAG
UTR dot + 25 …((((((.(((((((((………….(((..((((.(.(((….))).))))).)))))))))))).))))))…………((((…..))))…((.(..((((…..))))..)))…
RS 1 seq ACACGUGCUCCGGGGUCGGUGAAAGUCCGAACCGGCGGUGAUAGUCCGCGACCCGAGCCGUCCUCGUGGCGGUGAGGUUGAAUCGGUGAAAUUCCGGUACCGACGGUUACAGUCCGGAUGGGAGGUAGCACGGCA
RS 1 dot .(((.((((.(((((.((((….(((…….((((…….)))))))….)))).))))).))))))).(((…(((((…….))))))))..(((((((..(((….)))..))))).))…
RS 2 seq CUGGGUUGGUUGGGGUGUCCUUGACAAUUCUUUCUCGAAAAGCUUUCUUGAAAAGUACACAUUCAAGGCCUGAGAGAUACCCAUUGAACCUGAACCAGAUAAUACUGGCGUAGGAAACCGGCGAUCAAAAGUU
RS 2 dot ..(((((.(.(.(((((((………….(((((….((…((((((………)))))))).))))))))))))).).)))))…((((……))))(((.((…)).)))……….
RS 3 seq ACACAGCGCUCUGGAGAGAUCCGGCGGCCCCAAUUCCCGCGCAAGAUGGCGCGGGCGCGGCUGGCCCGGACGCCGAAGGUGCAAACCCGCAACGUCGCGGGGCAACUCUCAGGCAAAAGGACAGAGGGGCGGAA
RS 3 dot …..(((((.(.(.(.(.((((((((((……(((((((……)))))))…)))))..)))))).)).).)))))…(((((……)))))((..((((………….))))..))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table