Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064832 Similarity: 0.974 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA064832
Gene: MED24_4
MFE: -39.705
ENS: 0.866
Length: 135.
Predicted Ligands:
TPP - 14/20
SAM - 1/20
molybdenum - 1/20
 RS: URS0000D65C3A_12908
MFE: -35.155
Ligand: SAM
Species: unclassified sequences SAM-I/IV variant riboswitch
 RS: URS0000DA55C4_660596
MFE: -39.124
Ligand: molybdenum
Species: Pantoea stewartii subsp. stewartii DC283 Moco (molybdenum cofactor) riboswitch
 RS: URS0000D854A1_37928
MFE: -47.228
Ligand: TPP
Species: Arthrobacter crystallopoietes TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064832 URS0000D65C3A_12908 URS0000DA55C4_660596 URS0000D854A1_37928
Length 135. 134. 134. 134.
Similarity - 0.974 0.967 0.967
Ensemble Norm 0.866 - - -
MFE -39.705 -35.155 -39.124 -47.228
Ligands - SAM molybdenum TPP
Gene MED24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 4.001 2.020
Length SE - 1. 1. 1.
Lev Distance - 31. 41. 42.
UBS 9. 9. 8. 9.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 3.
ILR 2. 4. 3. 1.
H 2. 2. 2. 3.
BL 3. 4. 3. 3.
BR 2. 1. 1. 2.
UN 0.126 0.142 0.149 0.269

Sequences

Field Description
UTR seq + 25 gugcgguaggcuuaaauuuggggaggugguggaugaaaaggaaauugggagcuccauuucuuucaccucaaagcuggccgccaccgcugccaccugcucagagugaaauaATGAAGGTGGTCAACCTGAAGCAAG
UTR dot + 25 ..(((((.(((………((..(((((((((.((((.(((……….))).)))).))))))…..)))..)))))))))).(((((((..(((………..))))))))))…………..
RS 1 seq GCCCCGCAUCAAGAGACAGGACUUCGGUCCUCGCCAACCUGCCGACUCGGGUAAGGUGGUCGCCGCUAAGAGCGGGAUGUGGCUGAUUCAGGCAAAAAAACGAGCUAAAAAUCAGCAACUUAGUAGUAACGAGC
RS 1 dot ..(((((.((.((………..((((..(((((.(((((……)))))..)))))..))))))..)))))))..((.(((((((..(((……….)))…))))))).))……………
RS 2 seq CCGGUUAACGUACACUCAAGCCUGAAUGCCUACGUCUGCGGAUAGGGGAUUCAGGCCGUAGCCUCCGCGCUGCCAGGGUGCAGGAAGAAAUGACUGCAUCUCCCGAACUGGAAAGGUGUUCUCUGGUGUCACAA
RS 2 dot ..((((.(((………((((((((.(((………….))).)))))))))))))))…(((((.(((((((((((..(….)..)))))))…….))))…)))))……………
RS 3 seq AGAAAACACUGCGGGAGCCUGAUACGCGGCACGUGCGGCAAUUGCCGGCGGCCGACAGGCUGAGAGGGUGCCUGGCACCGACCGUCGAACCUGAUCCGGGUCAUGCCGGCGUAGGGAAGGAAGCUCAAAGUUGU
RS 3 dot ……………((((((…..((((.(((.((((….))))))))))).))))))…..(((((…)))))..((.((…((((..((((……))))..)))))).))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table