Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064835 Similarity: 0.963 Similarity: 0.963 Similarity: 0.961
UTR: 5HSAA064835
Gene: MED24_5
MFE: -39.986
ENS: 0.862
Length: 144.
Predicted Ligands:
cobalamin - 7/20
TPP - 5/20
molybdenum - 4/20
 RS: URS0000DB34C4_1230338
MFE: -27.806
Ligand: glycine
Species: Moraxella macacae 0408225 Glycine riboswitch
 RS: URS0000DB4638_393763
MFE: -30.974
Ligand: glycine
Species: Anaerobacillus alkalilacustre Glycine riboswitch
 RS: URS000232B030_393303
MFE: -59.021
Ligand: cobalamin
Species: Nocardioides sp. PD653 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064835 URS0000DB34C4_1230338 URS0000DB4638_393763 URS000232B030_393303
Length 144. 145. 145. 143.
Similarity - 0.963 0.963 0.961
Ensemble Norm 0.862 - - -
MFE -39.986 -27.806 -30.974 -59.021
Ligands - glycine glycine cobalamin
Gene MED24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 22. 8.
Length SE - 1. 1. 1.
Lev Distance - 45. 38. 48.
UBS 11. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 3. 1. 6. 2.
ILR 2. 3. 4. 3.
H 3. 4. 3. 2.
BL 3. 2. 0. 5.
BR 3. 3. 3. 4.
UN 0.083 0.097 0.076 0.098

Sequences

Field Description
UTR seq + 25 gugcgguaggcuuaaauuuggggaggugguggaugaaaaggaaauugggagcuccauuucuuucaccucaaagcuggccgccaccgcugccaccugcucagagugaaauaaugaaggugATGAAGGTGGTCAACCTGAAGCAAG
UTR dot + 25 (((((((.(((………((..(((((((((.((((.(((……….))).)))).))))))…..)))..)))))))))).))(((((..(((………..))))))))….((((…..))))……..
RS 1 seq CUGACAAUUUCAGGAGAGUAUGAUGUUAGGCUUGUUUGGCAAAACAGUGGUUGUUUUGACAAAAAUAGCCAAAUUCACAAUAAACAUCAUCACCGAAGGCGUAAAAACCCUAUAAUCGCUCAGGUAAAUGGACUGAAAUUGCAUU
RS 1 dot ((((…..))))….(((((((((((((((..((((.(((((((…..))))))).))))…))))……….))).)))))).))((((((.((….)))))….))).((((………))))………
RS 2 seq AUGAGAUCAAGGGGAGAGACUGCAAAGGUUUUAGUAGUUUUAAGCUAUAAACUAUUAAAAACUGAGGCUUUUUAGCCUAUCUGCAGCGCCGAAGGAGCAAGCGUAUAAUCGUGAAUCUCUCAGGCAAAAAGACUCUUGUUUGACG
RS 2 dot .((((((…(((..((((..((…((((((((((((((……..)))))))))))).))…)).))))..))))))).))..(((…((((…(((……)))….))))..)))….((((….))))….
RS 3 seq ACCGGCGUCCCCUAGGGUGGCCGCACGCGCGUCUCGUGGAACAGGAACCCGGUGAGAGUCCGGGGCGGUUCCGCCACUGUGACGCCGGUCCUCGUACCUGACGGCCGGCACAGCCAGACACUGGCCACGGGACAUUCACCCAA
RS 3 dot (((((((((…((((((((((((.((.((.((((.(((………)))..)))))).))..))))..))))).))).)))))))))….((.((((..((((((…………)))))).))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table