Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064867 Similarity: 0.977 Similarity: 0.977 Similarity: 0.974
UTR: 5HSAA064867
Gene: MED24_6
MFE: -23.183
ENS: 0.992
Length: 112.
Predicted Ligands:
guanidine - 18/20
glycine - 1/20
homocysteine - 1/20
 RS: URS0000C7AFBA_1223565
MFE: -49.804
Ligand: guanidine
Species: Rhizobium sp. Pop5 Guanidine-I riboswitch
 RS: URS0000127534_1211777
MFE: -46.704
Ligand: guanidine
Species: Rhizobium mesoamericanum STM3625 Guanidine-I riboswitch
 RS: URS0000C862FB_1333998
MFE: -41.168
Ligand: glycine
Species: Tepidicaulis marinus Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064867 URS0000C7AFBA_1223565 URS0000127534_1211777 URS0000C862FB_1333998
Length 112. 112. 112. 112.
Similarity - 0.977 0.977 0.974
Ensemble Norm 0.992 - - -
MFE -23.183 -49.804 -46.704 -41.168
Ligands - guanidine guanidine glycine
Gene MED24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2. 15.001
Length SE - 0. 0. 0.
Lev Distance - 30. 30. 29.
UBS 7. 7. 7. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 2. 1. 1. 1.
H 3. 3. 3. 3.
BL 2. 2. 2. 2.
BR 1. 1. 1. 4.
UN 0.179 0.170 0.170 0.143

Sequences

Field Description
UTR seq + 25 ggugcgaucucggcucaccccaacaaccuccgccucccggguucaagcgauucuacugccucagccucccgaguagcugggauuacaATGAAGGTGGTCAACCTGAAGCAAG
UTR dot + 25 ((((.((((…(((.((((………………))))…))))))).))))..((((((..(….)..))))))……….((((…..))))……..
RS 1 seq UGAGUUGGUGGCUAGGGUUCCGGCGCUUUUCUGAAGUGCGGCUGGUCCGAGAGCCACCACCGGUGGGGGAGAAAUCCCGCCGGGUGCACGGCGGGACAAAAGCCCGGGAGAC
RS 1 dot …..((((((((.(((..(((((((………..))).)))))))…))))))))(((((((((……)))))))))……..((((.(….)))))……
RS 2 seq UGAGUUGGUGGCUAGGGUUCCGGCGCUUUCCUGAAGUGCGACUGGUCCGAGAGCUACCACCGGCCGGGGAGAAAUCCGGUCGGGUGCACGGCGGGACAAAAGCCCGGGAGAC
RS 2 dot …..((((((((.(((..(((((((………..))).)))))))…))))))))(((((((((……)))))))))……..((((.(….)))))……
RS 3 seq CACUCUGGAAAGCAGGCCGCGCCUUUUAAGCUGCGCGUGGGCCUCACCGAAGGAGUAAGCCCGGCGCGCCGCGUGAGCCGGGUCAAAUCUCUCAGGUAGAUGGGACAGAGGG
RS 3 dot .(((((((…(.((((((((((………).)))))).)))).))…)))))..(((((((.(((…))).)))))))……(((((……)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table