Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064878 Similarity: 0.964 Similarity: 0.963 Similarity: 0.963
UTR: 5HSAA064878
Gene: MED24_7
MFE: -47.234
ENS: 0.996
Length: 150.
Predicted Ligands:
FMN - 12/20
cobalamin - 5/20
TPP - 2/20
 RS: URS0000AB6634_469371
MFE: -59.149
Ligand: cobalamin
Species: Thermobispora bispora DSM 43833 AdoCbl riboswitch
 RS: URS00019A99AE_2653131
MFE: -55.944
Ligand: FMN
Species: Arthrobacter sp. 9AX FMN
 RS: URS0002329302_1776083
MFE: -55.981
Ligand: FMN
Species: Microbacterium sp. T32 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064878 URS0000AB6634_469371 URS00019A99AE_2653131 URS0002329302_1776083
Length 150. 149. 150. 151.
Similarity - 0.964 0.963 0.963
Ensemble Norm 0.996 - - -
MFE -47.234 -59.149 -55.944 -55.981
Ligands - cobalamin FMN FMN
Gene MED24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 3.006 8.003
Length SE - 1. 0. 1.
Lev Distance - 44. 48. 44.
UBS 12. 12. 12. 13.
BS 0. 0. 0. 0.
ILL 5. 4. 4. 5.
ILR 3. 3. 3. 5.
H 2. 2. 1. 1.
BL 4. 6. 3. 5.
BR 5. 5. 5. 4.
UN 0.093 0.067 0.013 0.040

Sequences

Field Description
UTR seq + 25 accuacuaacuaggggcuaacgaaugaaagggugucggaauaugauggagaagcccggucgacagugacgucgugggcgacgccggguugugagcggccuuucgagcucccucgagucccugaguATGAAGGTGGTCAACCTGAAGCAAG
UTR dot + 25 …((((…((((((((…((.(((((((.(((((.(((….(((.(..(((((..((((……)))))))))..).))).))).))).)).)))))))…))…..))))))))))))…((((…..))))……..
RS 1 seq UUUCGAGGGAGUUCGCGGCGGUUCAAGGGAAAUCCGGUGAGAGGCCGGUGCGGACGCGCCACUGUAUCCGGGACGUCGAUCCCGGGAGCCAGGUCGCUUGAACCGUCGUGGGACCUCACCGUAUGGGCGCGUUAUCCCAGAAGGAGGCA
RS 1 dot ….((((…((((((((((((((((.((..(((((.((..((.((.(.((((.((……)).)))).).))))..)))))))…….)).)))))))))))))))).)))).((…((((……..))))…))…..
RS 2 seq AUACGUGCUCCGGGGUCGGUGUAAGUCCGAACCGGCGGUGACAGUCCGCGACCCGCGAGCCGGUGCUUCCCCAGGGAGGACACCGGCGGACGGUUGAACCGGUGAAAUUCCGGUACCGACAGUUAAAGUCUGGAUGAGAGAAGCACGUAC
RS 2 dot .((((((((((((((((((((…..(((((.((.((((..(((.(((…((…..(((((((((((……)))).))))))))).)))))).)))).))…))).)))))))))……..))))))……..))))))).
RS 3 seq AUACGUGCUCCGGGGUCGGUGUGAAUCCGAACCGGCGGUGACAGUCCGCGAACCCCUCCGCUUCGGCGGUGGGGCCGAUCCGGUGGAAUUCCGGAACCGACGGUGAUGAGGCGAGUGAUCUCCUCUAGUCCGGAUAGGAGGCAGCACGGUC
RS 3 dot …(((((((((((((((.(.((..((…((((.((((…..((((.(((..((.(((..(((((……)))))..))).))..))))))))))).))))…))..))).)))))))……………..)).))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table