Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064891 Similarity: 0.987 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA064891
Gene: MED25
MFE: -37.125
ENS: 0.946
Length: 78.
Predicted Ligands:
cobalamin - 11/20
zmp-ztp - 6/20
preQ_1 - 2/20
 RS: URS000232E97F_393303
MFE: -36.880
Ligand: zmp-ztp
Species: Nocardioides sp. PD653 ZMP/ZTP riboswitch
 RS: URS0002330E1D_1618521
MFE: -12.712
Ligand: cobalamin
Species: Microgenomates group bacterium GW2011_GWC1_43_13 AdoCbl variant RNA
 RS: URS0000ABBFE0_102897
MFE: -34.102
Ligand: cobalamin
Species: Frankia sp. EUN1f Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064891 URS000232E97F_393303 URS0002330E1D_1618521 URS0000ABBFE0_102897
Length 78. 78. 79. 77.
Similarity - 0.987 0.985 0.985
Ensemble Norm 0.946 - - -
MFE -37.125 -36.880 -12.712 -34.102
Ligands - zmp-ztp cobalamin cobalamin
Gene MED25 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.003 2. 3.
Length SE - 0. 1. 1.
Lev Distance - 18. 18. 18.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 1. 1. 1. 1.
H 3. 3. 3. 3.
BL 2. 2. 1. 1.
BR 1. 1. 1. 2.
UN 0.090 0.141 0.101 0.104

Sequences

Field Description
UTR seq + 25 auuccgcggcgucggcugcggcugcaguggugguggcggguaccgcacgggguATGGTCCCCGGGTCCGAGGGCCCGG
UTR dot + 25 …(((((((….)))))))((((….))))…(((((.((((.(((((……))))).))….))))))).
RS 1 seq AACUGCUCGCGCGUCUUGGCGUAGUCGAGGGCCACCUCGUAGGCGGCGCGCGCGAUGCCGAUCGCCUGGGCGCCGACG
RS 1 dot ….(((.((((……)))))))(((((….)))))….((((((.((((((….)))))..).))))))…
RS 2 seq UAAAUUAGUUCCUGUUGGUGAAUUACGGCGAAAAUCCGUAGAAGUGCCGCUACUGUUAUAUCCAGAGCCCAACUUUUCA
RS 2 dot …..((((((((…)).))))))(((…….))).((((((…(((.(((…….))))))…))))))..
RS 3 seq GGAAGCCGGUGAGAUUCCGGCGCGGCCGCGCCACUGUGACCGCCUGUGGGGAUUUCCCUCAAGGGCGGAAGCCAGAC
RS 3 dot ….(((((…….)))))(((….)))..((((..((((((.(((((…..))))).))))))..)).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table