Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064915 Similarity: 0.985 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA064915
Gene: MED29
MFE: -7.427
ENS: 0.969
Length: 62.
Predicted Ligands:
fluoride - 12/20
cobalamin - 6/20
glutamine - 2/20
 RS: URS0000AB77D6_910954
MFE: -20.063
Ligand: cobalamin
Species: Dietzia cinnamea P4 Cobalamin riboswitch
 RS: URS0000C28990_1777878
MFE: -12.702
Ligand: fluoride
Species: Streptococcus sp. DD10 Fluoride riboswitch
 RS: URS0000D97846_1797662
MFE: -25.819
Ligand: cobalamin
Species: Chloroflexi bacterium RBG_16_70_13 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064915 URS0000AB77D6_910954 URS0000C28990_1777878 URS0000D97846_1797662
Length 62. 61. 62. 61.
Similarity - 0.985 0.984 0.983
Ensemble Norm 0.969 - - -
MFE -7.427 -20.063 -12.702 -25.819
Ligands - cobalamin fluoride cobalamin
Gene MED29 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.084 12.031 12.016
Length SE - 1. 0. 1.
Lev Distance - 17. 18. 18.
UBS 5. 4. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 1. 1.
H 3. 3. 2. 2.
BL 1. 0. 0. 0.
BR 2. 0. 0. 0.
UN 0.339 0.049 0.161 0.213

Sequences

Field Description
UTR seq + 25 ggcgggacuaacuagcaaacggggacuagaaauagggATGCTGAAAAGCAACGGGGAGAGAC
UTR dot + 25 .((((……)).))………(((….))).(.((((….)))).)……….
RS 1 seq GUCGGUGCGAAUCCGACGCUGUCCCGCAACUGUGAUCCCGUCCCCGGACGGGCGAGCCAGG
RS 1 dot (((((…….)))))((……))..(((….((((((….))))))…..))).
RS 2 seq UAUCCAUAAAGGGAUGGUGCUCCCUAUAAACGCUAGAAAUAGCUGAUGGCGCCUGUUAGAAA
RS 2 dot .((((……))))((((((……….((((….))))….))))))………
RS 3 seq GCCGGUGCGAUUCCGGCACAGUCCCGCUACGGUGAACCGUCGCCCAGCGACGGAAGUCCGG
RS 3 dot (((((…….)))))…………(((….(((((((…)))))))….))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table