Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064925 Similarity: 0.988 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA064925
Gene: MED6
MFE: -11.695
ENS: 0.910
Length: 55.
Predicted Ligands:
unknown - 18/20
TPP - 1/20
fluoride - 1/20
RS: URS0000D4ACC6_1336806
MFE: -12.742
Ligand: TPP
Species: Reinekea forsetii TPP riboswitch
RS: URS0000E60855_1294143
MFE: -18.729
Ligand: unknown
Species: Pseudomonas denitrificans ATCC 13867 nhaA-I RNA
RS: URS000050FA1E_321967
MFE: -10.740
Ligand: fluoride
Species: Lactobacillus casei ATCC 334 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064925 URS0000D4ACC6_1336806 URS0000E60855_1294143 URS000050FA1E_321967
Length 55. 54. 55. 55.
Similarity - 0.988 0.986 0.985
Ensemble Norm 0.910 - - -
MFE -11.695 -12.742 -18.729 -10.740
Ligands - TPP unknown fluoride
Gene MED6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.004 8.033 3.008
Length SE - 1. 0. 0.
Lev Distance - 14. 16. 19.
UBS 3. 3. 4. 3.
BS 0. 0. 0. 0.
ILL 1. 2. 3. 0.
ILR 1. 1. 2. 0.
H 1. 1. 1. 2.
BL 1. 0. 0. 1.
BR 1. 1. 0. 1.
UN 0. 0.333 0.218 0.309

Sequences

Field Description
UTR seq + 25 gaaagagaaccuguaaacgcucucggaauuATGGCGGCGGTGGATATCCGAGACA
UTR dot + 25 ………………..(((((((….(.((….)).)…)))))))..
RS 1 seq GCUGAGAAAAACCCGUUGAACCUGAACCAGUUUGUACUGGCGUAGGGAGCAAAG
RS 1 dot …………..(((…((((..(((((….)))))..)))).)))….
RS 2 seq GGGUGUCUGCUGCAAGGGUGGCGAGACAGGUCAAUGCGCAGGUCGGGCCGCCGCG
RS 2 dot ………..((…((((((..(((..((……))..)))..)))))))).
RS 3 seq AAAUUAAAUGGCGAUGGUGUUCGCCUAUACGCAAGUUGAUGACACCUACCUUGAG
RS 3 dot ………(((((……)))))……((((.((……..)).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table