Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064928 Similarity: 0.982 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA064928
Gene: MED6_0
MFE: -17.562
ENS: 0.990
Length: 72.
Predicted Ligands:
fluoride - 9/20
cobalamin - 5/20
purine - 2/20
 RS: URS0000D862BF_1293890
MFE: -18.108
Ligand: SAM
Species: Thalassospira alkalitolerans SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D93C80_1515439
MFE: -17.686
Ligand: fluoride
Species: Paraburkholderia susongensis Fluoride riboswitch
 RS: URS0000D8DDA5_1803461
MFE: -26.072
Ligand: fluoride
Species: Acidobacteria bacterium 13_2_20CM_2_57_6 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064928 URS0000D862BF_1293890 URS0000D93C80_1515439 URS0000D8DDA5_1803461
Length 72. 72. 72. 73.
Similarity - 0.982 0.982 0.981
Ensemble Norm 0.990 - - -
MFE -17.562 -18.108 -17.686 -26.072
Ligands - SAM fluoride fluoride
Gene MED6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 2.001 5.002
Length SE - 0. 0. 1.
Lev Distance - 23. 24. 23.
UBS 4. 4. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 1. 2. 1. 1.
H 2. 2. 2. 2.
BL 1. 0. 2. 2.
BR 1. 0. 1. 1.
UN 0.056 0.111 0.083 0.096

Sequences

Field Description
UTR seq + 25 acguuuacuuugcgccggaaagagaaccuguaaacgcucucggaauuATGGCGGCGGTGGATATCCGAGACA
UTR dot + 25 .(((((((…………………))))))).(((((((….(.((….)).)…)))))))..
RS 1 seq UCUGCCUAUCGUGGGAUUUGUCGACCGGCUUGCGGCCACGUAAAAAAUCGCUAAAGAGGGGAAUCGUGGCUU
RS 1 dot …(((..(((……….)))..)))….(((((((…….((……))…….))))))).
RS 2 seq GAUUUUUGCGGAGAUGGCAUUCCUCCCUAACUGCCGCUAGCAAGCUUUGCGGCUAAUGAUGCCUACAGGGUC
RS 2 dot ….(((((..((.(((((…………))))))).)))))(((((.(((…….)))..)))))..
RS 3 seq CAUUCUGGAGGCGAUGGAGUUCGCCAUAACCGUCCCGGCGCUGUUCACCGGGUCUGAUGACUCCUGGCAGCAG
RS 3 dot ….((((.((((((((……))))…)))))))).((((.(((..(((((….))))).)))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table