Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064937 Similarity: 0.980 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA064937
Gene: MED8
MFE: -30.303
ENS: 0.936
Length: 73.
Predicted Ligands:
cobalamin - 10/20
fluoride - 5/20
SAM - 2/20
 RS: URS0000BF32F4_649756
MFE: -11.606
Ligand: fluoride
Species: Eubacterium hadrum Fluoride riboswitch
 RS: URS000232C36D_1802056
MFE: -23.650
Ligand: cobalamin
Species: Candidatus Roizmanbacteria bacterium RIFCSPLOWO2_01_FULL_37_12 AdoCbl variant RNA
 RS: URS0000C3017B_1078086
MFE: -33.886
Ligand: cobalamin
Species: Streptomyces sp. HGB0020 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064937 URS0000BF32F4_649756 URS000232C36D_1802056 URS0000C3017B_1078086
Length 73. 74. 73. 74.
Similarity - 0.980 0.980 0.980
Ensemble Norm 0.936 - - -
MFE -30.303 -11.606 -23.650 -33.886
Ligands - fluoride cobalamin cobalamin
Gene MED8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.003 24.042 6.007
Length SE - 1. 0. 1.
Lev Distance - 23. 18. 24.
UBS 7. 7. 5. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 3. 0.
ILR 0. 1. 0. 0.
H 2. 2. 1. 3.
BL 2. 4. 1. 2.
BR 5. 4. 2. 3.
UN 0.205 0.149 0. 0.122

Sequences

Field Description
UTR seq + 25 gacuggaaaaccggaagugaaaucguggcagccgccucggccgccgcaATGCGGCAGACTGAAGGACGGGTGC
UTR dot + 25 ..((((….))))………….(((.((((((((((.(((((…))))).).))).))).))).)))
RS 1 seq AAAGAAAAAGGGAAUGAAGUUCUCCCUCGAAGAGAUUCGAAACCGCUUAUUAAGCUGAUGACUUCUGUGCGAUG
RS 1 dot ………((((………))))(((.(.(((.(((…(.((((…)))).).)))..))).).)))..
RS 2 seq GGUUUGGACCGCAGGAACUUAGGUGCAAUUCCUAGGCUGUGCCGCAACGGUAAAGUCCGGAACUGCCCAAACC
RS 2 dot (((((((…((((…………..((((..((((.(((((…))))).)))).)))))))))))))))
RS 3 seq GGAAGCCGGUGCAAGUCCGGCACGGUCGCGCCACUGUGUGCCGUCGCUUCGCAAGAGGCGAGGGCGAGUCAGAC
RS 3 dot ….(((((…….)))))..(((…))).((((.((((.(((((((….))))))).)))).).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table