Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064939 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA064939
Gene: MED8_0
MFE: -26.959
ENS: 0.963
Length: 69.
Predicted Ligands:
fluoride - 10/20
cobalamin - 8/20
2'-dG-II - 1/20
 RS: URS0000BE364E_1210046
MFE: -19.436
Ligand: cobalamin
Species: Janibacter hoylei PVAS-1 Cobalamin riboswitch
 RS: URS0000AB3A8A_645465
MFE: -27.786
Ligand: cobalamin
Species: Streptomyces sp. e14 Cobalamin riboswitch
 RS: URS0000BF6AA6_1246995
MFE: -23.561
Ligand: cobalamin
Species: Actinoplanes friuliensis DSM 7358 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064939 URS0000BE364E_1210046 URS0000AB3A8A_645465 URS0000BF6AA6_1246995
Length 69. 69. 69. 71.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.963 - - -
MFE -26.959 -19.436 -27.786 -23.561
Ligands - cobalamin cobalamin cobalamin
Gene MED8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.013 24.002 13.003
Length SE - 0. 0. 4.
Lev Distance - 23. 20. 20.
UBS 8. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 0. 0. 1. 1.
H 2. 3. 3. 2.
BL 2. 3. 1. 3.
BR 6. 3. 2. 3.
UN 0.087 0.203 0.130 0.141

Sequences

Field Description
UTR seq + 25 ggaaaaccggaagugaaaucguggcagccgccucggccgccgcaATGCGGCAGACTGAAGGACGGGTGC
UTR dot + 25 ……((((……..))).)(((.((((((((((.(((((…))))).).)))).)).))).)))
RS 1 seq GAGGAAUCCGGUGCAACUCCGGAGCGGUCCCGCCACUGUCACGGCCCACGCGGCCCGAGCCAGACACUC
RS 1 dot ……(((((…….)))))(((….)))..(((.(.(((.((….)).))).).)))……
RS 2 seq GGAAGCCGGUGAGAGUCCGGCACGGUCGCGCCACUGUGAACGGACGCCCCAGGCGUGCGUGAGUCAGAC
RS 2 dot ….(((((…….)))))..(((…))).((((..(((.(((((…))))).)))..).)))..
RS 3 seq GGAAACCGGUGAAAAUCCGGUGCGGUCGCGCCACUGUGAACGGAUCCCCCGGGAGCCGUGAGUCAGGACGC
RS 3 dot ….(((((…….)))))……(((.(.((((..((((.(((….))).))))..).)))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table