Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064999 Similarity: 0.959 Similarity: 0.953 Similarity: 0.951
UTR: 5HSAA064999
Gene: MEIG1
MFE: -47.516
ENS: 0.992
Length: 173.
Predicted Ligands:
cobalamin - 12/20
lysine - 4/20
Mg2+ - 2/20
 RS: URS0002328656_1535422
MFE: -33.661
Ligand: cobalamin
Species: Thalassotalea sp. ND16A Cobalamin riboswitch
 RS: URS0000DA026C_1965603
MFE: -39.497
Ligand: lysine
Species: Blautia sp. An249 Lysine riboswitch
 RS: URS0000BEED5F_745411
MFE: -63.720
Ligand: lysine
Species: Gallaecimonas sp. 3-C-1 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064999 URS0002328656_1535422 URS0000DA026C_1965603 URS0000BEED5F_745411
Length 173. 173. 173. 174.
Similarity - 0.959 0.953 0.951
Ensemble Norm 0.992 - - -
MFE -47.516 -33.661 -39.497 -63.720
Ligands - cobalamin lysine lysine
Gene MEIG1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.005 10.012 7.021
Length SE - 0. 0. 1.
Lev Distance - 52. 60. 62.
UBS 9. 8. 9. 10.
BS 0. 0. 0. 0.
ILL 0. 2. 1. 2.
ILR 2. 2. 0. 2.
H 4. 3. 5. 4.
BL 3. 2. 3. 4.
BR 1. 2. 3. 2.
UN 0.301 0.370 0.191 0.155

Sequences

Field Description
UTR seq + 25 ccugcucgcggaucccgaguagagaacgcaagcacccacgcccgccugcaagcucccgggcgcccccggccucuccugcucggcggaacgaggauaacccaguagagccggacccagggauauuauugauaauaaggccucuguaaccATGGCTAGTTCTGACGTAAAACCAA
UTR dot + 25 .(((((((.(….))))))))…………….((((((…………))))))(((((((.((((.(((((((……))))…….))).))))))))…..)))…………….((((………..))))……………….
RS 1 seq UCGACGCGUAAAAUUUAAGGUGUCCUGAACUGUAACAAACUUCAAGACUUAAUAGGGAAUGUGGUGCAAUAGGCAAAAUGGCUUAUUAAUUCCACAGCUGUUCCCGCAACUGUAAAUAGAAUCAAUGAAAACAUUCUAUGAGUCAGAAAACCUGCCUUAAAUGUUAAUUAAUG
RS 1 dot ..(((((.(……..).)))))…………………………((((((((((…(((((((……)))))))….)))))….)))))……………………((((((…((((.(((…..))).))))))))))……..
RS 2 seq GGGAAAGAUAGAGGAUGCGUUUUUUAUCAGUAGACGGCUGGAUAUGCAGGGAUAGGAGAAGGCCGGUGAAAGGAAAAAACGCCGAAAGGAUAAGACUCCUGCGGUUUUAUUGCUUGGGCAUACAGUGAAGAACUGUAUGACUGUCAUCAAAACGAUGGUGCGCUAUCUGAAGG
RS 2 dot ……(((((((((….)))))))))……(((((…………………)))))….(((.((.(((.((((..((((……)))).))))))).)).)))…((((((((…..))))))))((((((……..))))))…………..
RS 3 seq GCGCCAAGUAGAGGUGCGUCCUGGAUGAGUCGCCGGGGGGAAGGUGAUGCUGUGGAUCCCCGGUAAAAGGCCAGUGCGCCGAAGUGAAGCCGACAUCAAGCGGUUUUGCUGGUGUCGUGGGCGAAAGUCGCGGCACUGCCAUAGUCCUAAACACUAUGGAGCGCUACCGAAGGC
RS 3 dot (((((…….)))))…………..((((((((……………..))))))))….(.(((..(((((..((((((((((……..)))))))))))))))..))).)…..(((.(((.((.(((((((…….))))))))).)))..)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table