Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA065042 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA065042
Gene: MEMO1
MFE: -33.630
ENS: 0.958
Length: 95.
Predicted Ligands:
TPP - 13/20
SAM - 3/20
glycine - 2/20
 RS: URS0000ABB99D_367110
MFE: -23.146
Ligand: TPP
Species: Neurospora crassa OR74A TPP riboswitch (THI element)
 RS: URS0000C3139C_1423792
MFE: -25.932
Ligand: TPP
Species: Lactobacillus perolens DSM 12744 TPP riboswitch (THI element)
 RS: URS00019C69F8_2653135
MFE: -30.021
Ligand: TPP
Species: Citricoccus sp. K5 TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA065042 URS0000ABB99D_367110 URS0000C3139C_1423792 URS00019C69F8_2653135
Length 95. 94. 96. 94.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.958 - - -
MFE -33.630 -23.146 -25.932 -30.021
Ligands - TPP TPP TPP
Gene MEMO1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.006 4. 4.005
Length SE - 1. 1. 1.
Lev Distance - 24. 27. 27.
UBS 7. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 3.
ILR 1. 2. 2. 2.
H 2. 2. 2. 2.
BL 1. 3. 1. 2.
BR 3. 3. 4. 3.
UN 0.095 0.170 0.094 0.021

Sequences

Field Description
UTR seq + 25 ugcugccgcuaaaccccggagagcggagcgugcacguugagauuccucggcgggcggcacaggcaccaagATGTCCAACCGAGTGGTCTGCCGAG
UTR dot + 25 .(((((((((…..(((…..))))))).))).))……..((((((((((.((…((((……))))…….)).))))))))))
RS 1 seq GAUGGGCCAACUGCGGCGGUACCACGUUGGUCUGAGAAAUACCGGCGAACUUGAUCUGGAUAAUACCAGCGAAAGGAUUGGCUUCUUGGGACCC
RS 1 dot …((((((((.(.((…..)).)))))))))……..(((((.(((((…((((……))))….))).)).)))….))…..
RS 2 seq ACCAUCACAAAGGGGAGCCAAUUGGCUGAGAGUGAGCGAUCAGACCCUUCGAACCUGUUCGUUAAUGCGAGCGUAGGGAUUGUGAGUGGUAUUGAA
RS 2 dot ….((((…….((((….))))….))))….(((((((((((((.(((((((((….))))))…))).))).))).))).)))).
RS 3 seq GGCGCGGACACGGGGUGCGCCGACCGGCGCUGAGAUCAAACCCGUGGAACCUGAUCUAGUUCGAACUAGCGAAGGGAUGUCCACGUGACUUCUU
RS 3 dot (((((((…(((……))).))).))))(((.(((….((((((.(((…(((((….)))))….)))…))))))))).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table