Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA065070 Similarity: 0.963 Similarity: 0.960 Similarity: 0.960
UTR: 5HSAA065070
Gene: MEPCE
MFE: -48.883
ENS: 0.822
Length: 138.
Predicted Ligands:
cobalamin - 12/20
FMN - 8/20

 RS: URS0000C89BC2_698760
MFE: -71.589
Ligand: cobalamin
Species: Streptomyces turgidiscabies Car8 Cobalamin riboswitch
 RS: URS0000C6412F_241244
MFE: -38.106
Ligand: FMN
Species: Rummeliibacillus stabekisii FMN riboswitch (RFN element)
 RS: URS00023227EA_1470176
MFE: -60.484
Ligand: cobalamin
Species: Actinoalloteichus hoggarensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA065070 URS0000C89BC2_698760 URS0000C6412F_241244 URS00023227EA_1470176
Length 138. 138. 137. 138.
Similarity - 0.963 0.960 0.960
Ensemble Norm 0.822 - - -
MFE -48.883 -71.589 -38.106 -60.484
Ligands - cobalamin FMN cobalamin
Gene MEPCE - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.003 5.001 20.010
Length SE - 0. 1. 0.
Lev Distance - 47. 51. 47.
UBS 7. 6. 8. 7.
BS 3. 3. 3. 4.
ILL 1. 2. 1. 1.
ILR 0. 2. 1. 3.
H 3. 3. 4. 3.
BL 2. 1. 3. 3.
BR 4. 3. 3. 1.
UN 0.188 0.138 0.161 0.087

Sequences

Field Description
UTR seq + 25 gcagagcugcgcgcgcacucgggaaaggggggaagggagcaggguccaggcaggggggguuaggcccccugaucccccucguuaccccgacuggcacggaauaaggggaggaaATGGTGGGCCTGGATATCGATTCCC
UTR dot + 25 …(((.(((….))))))…………..(((((..((((((((((..(((((((((((…)))))))))))(((((.((((..((………..)).)).)).)))))…)))))))).))..)))))
RS 1 seq GGGGAAGUCCGGUGAGACUCCGGCGCUGACCCGCAACGGUAUGCACGCCUCUUGUCCGGCUGUUCGGCUGUUCGGCUGUUCGGCCGGGCAGUCACCUGGCUGUCCGGCCGGGACUGGGGUGUGCGAGCCCGAUCACCC
RS 1 dot (((..(((((((…….)))).)))..)))…..(((.((((((((((..(((((((((..(….)..)))))…(((((((((((((….))))))))))))))))).)))))))))).)))………
RS 2 seq AUUCAUCUUCGGGGCAGGGUGAAAUUCCCGAUCGGCGGUAUUAGAGGCAUUUUGACCUCUUGAGCCCGCGAGCCGUUAAGGCAGGACUUGGUGAGAAUCCAGGGCCGACAGUAUAGUCUGGAUGGGAGAAGGUGAAG
RS 2 dot .(((((((((……………((((.(((.((((..(((((((((…)).))))).))..))))..(((…..))).((.(((((…….))))).))..(((……))))))))))))))))))).
RS 3 seq CGUCGUCCCUCCACAGGGGACGAAUGCACGACGCCGUUCGACGGGGGAAGCCGGUGGGAGUCCGGCACUGUCCCGCAGCCGUGAGCAUCCGAGUCCUCGGGUGUGAGUCGGAAUGCCCGUCAACGGUUCUGUUCAGCU
RS 3 dot ..((((((((…..))))))))..((..(((((((((.(((((((((.(((((…….)))))….))))(((.((((..((((((((….))))))))..).)))..))))))))))))))…)))..)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table