Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA065303 Similarity: 0.971 Similarity: 0.969 Similarity: 0.967
UTR: 5HSAA065303
Gene: METTL5
MFE: -46.697
ENS: 0.987
Length: 132.
Predicted Ligands:
cobalamin - 4/20
Mn2+ - 3/20
FMN - 3/20
 RS: URS0000C74820_1262955
MFE: -47.756
Ligand: tetrahydrofolate
Species: Ruminococcus sp. CAG:353 THF riboswitch
 RS: URS0000AB9CC7_12908
MFE: -27.881
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000AB4563_182337
MFE: -36.320
Ligand: molybdenum
Species: Erwinia billingiae Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA065303 URS0000C74820_1262955 URS0000AB9CC7_12908 URS0000AB4563_182337
Length 132. 132. 131. 131.
Similarity - 0.971 0.969 0.967
Ensemble Norm 0.987 - - -
MFE -46.697 -47.756 -27.881 -36.320
Ligands - tetrahydrofolate cobalamin molybdenum
Gene METTL5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 10. 15.
Length SE - 0. 1. 1.
Lev Distance - 37. 36. 37.
UBS 10. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 2.
ILR 0. 1. 2. 3.
H 4. 4. 3. 4.
BL 4. 3. 4. 3.
BR 4. 3. 3. 2.
UN 0.091 0.091 0.084 0.076

Sequences

Field Description
UTR seq + 25 gaacgcgugcgcgcgugcggccuggcgcuuccggcaccggccgaggugcgggucgccuccagagauccugugccuucaaacccuacgaguccauacuuuaaaacaaaATGAAGAAAGTAAGGCTTAAGGAAC
UTR dot + 25 ..(((((….))))).(((((.((.(((…))).)))))))(((((((((((………)).)))))))))……(((..(((.((.((((((…………..)))))).))))).)))…
RS 1 seq UACAGAGUAGAUGACUGUGCGUUUGGAGCCUGAAUACAGGCACCGCAGUGUCCCGACAACGGGGAGUUGUGUCGGGGACGAAAUUUUCCGCUGAAAAGCGGAAAUGCGGUACAGUCAUCGCAUCCCGCUGAA
RS 1 dot ..((.(((…..))).))….(((.(((((….))))).)))((((((((((((.((((….)))))))))))………..)))))…(((((..(((((((……))))))).)))))…
RS 2 seq AUACUGAAAAGCAUGGUGGGAAAUCAGUGUGAAAUUCAUUGGCUGUUCCUGCAACCGUAAAGUCGGAGCGCCACCCAGUAUAGACCCCUGUCGAAUGAUGGCCAGGAAAAGCCUAAUUCUACAAUACUUAA
RS 2 dot ….((((…((((.(((….))).))))…)))).((((.(((((.((………)).)))))))))…(((((…….(((.((((…(((……..)))..)))).))))))))…
RS 3 seq UUCGGUAAAUCACACUUAGCCCUGACACCUAAGUCUCCUGAUACGGUGUCCUGGCCGCAACCUCGCGUUGCCAGGGUGCAGAAAGAAAUGCCUGCAUCUCCCGAUUUGGAAGGUGUUCUGGUGUCACAAUU
RS 3 dot …(((.((……)).)))..((((((…(((….)))..))))))((((((((……)))..))))).(((………(((((.((((((.((…..)).))))))…))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table