Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA065336 Similarity: 0.974 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA065336
Gene: METTL7A
MFE: -22.727
ENS: 0.865
Length: 111.
Predicted Ligands:
SAM - 6/20
TPP - 4/20
molybdenum - 3/20
 RS: URS0000D789A9_1395587
MFE: -20.898
Ligand: purine
Species: Paenibacillus sp. MAEPY2 Purine riboswitch
 RS: URS0002332BA2_435908
MFE: -29.124
Ligand: SAM
Species: Pseudidiomarina salinarum SAM-I/IV variant riboswitch
 RS: URS000232A6D7_1869301
MFE: -31.849
Ligand: cobalamin
Species: Desulfobacterales bacterium C00003106 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA065336 URS0000D789A9_1395587 URS0002332BA2_435908 URS000232A6D7_1869301
Length 111. 111. 111. 112.
Similarity - 0.974 0.973 0.972
Ensemble Norm 0.865 - - -
MFE -22.727 -20.898 -29.124 -31.849
Ligands - purine SAM cobalamin
Gene METTL7A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 18.004 5.010 15.008
Length SE - 0. 0. 1.
Lev Distance - 29. 35. 31.
UBS 7. 4. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 3.
ILR 0. 0. 1. 3.
H 3. 3. 4. 3.
BL 2. 0. 1. 2.
BR 2. 0. 1. 0.
UN 0.297 0.360 0.198 0.205

Sequences

Field Description
UTR seq + 25 aaucaaauacauuuaagaaauacauugguucaguccagaaaggcaggacaacccgacgcgaggcagggagcuuccagguuauagcaATGGAGCTTACCATCTTTATCCTGA
UTR dot + 25 ……………………..((((..((((………))))))))……(((((…..)))))((((.((.((..((((……)))))).)).)))).
RS 1 seq CAACAAAUGCAUAUUUCAUCUCGUAUAACCUCGCAGGCCGAAAGUGUACACAGGGCGAGGGUCUCUACAGGAAGCCUAUACUUCCUAACUACGAUGCCAGGGAAUCAUUGU
RS 1 dot ……………………….((((((…((………….))))))))……..((((((……))))))….((((((………))))))
RS 2 seq CCGCAACAUCAAGAGAAGAGCAACGCUCUCGCCAACCUGCUUUCGGGUAAGGUGGCCUCCGACUCCCAGUCGGGAUGUGCCUAUUAUGAGAAUAGGAAUCAUCAGAGAUUG
RS 2 dot …………((((……….))))(((.(((((((….)))).))))))..((((((…))))))((((..((((((…..))))))…))))……..
RS 3 seq UGUGAUCGGGACGAAAGCCGCAAACAGGCCACUGACCGCCUUGGGCGGAUGGAAAGGCGCGGCAAGUAGGACGAACGUAAGCCAGGAGACCCGGACAAGGCCGAACACUCCA
RS 3 dot …………….(((((……(((.((..(((((…)))))..))…))))))))…..((.(……..))).((((…(((……)))….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table