Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA065645 Similarity: 0.950 Similarity: 0.945 Similarity: 0.945
UTR: 5HSAA065645
Gene: MGAT2
MFE: -80.851
ENS: 0.903
Length: 194.
Predicted Ligands:
cobalamin - 13/20
FMN - 4/20
lysine - 3/20
 RS: URS0000C84BE7_1380763
MFE: -66.537
Ligand: FMN
Species: Paenibacillus darwinianus FMN riboswitch (RFN element)
 RS: URS0002312D99_2064
MFE: -90.145
Ligand: cobalamin
Species: Kitasatospora griseola Cobalamin riboswitch
 RS: URS000232F815_1121131
MFE: -53.
Ligand: cobalamin
Species: Butyrivibrio fibrisolvens DSM 3071 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA065645 URS0000C84BE7_1380763 URS0002312D99_2064 URS000232F815_1121131
Length 194. 194. 196. 193.
Similarity - 0.950 0.945 0.945
Ensemble Norm 0.903 - - -
MFE -80.851 -66.537 -90.145 -53.
Ligands - FMN cobalamin cobalamin
Gene MGAT2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 7.003 5.004
Length SE - 0. 4. 1.
Lev Distance - 62. 63. 70.
UBS 14. 16. 14. 15.
BS 0. 0. 1. 0.
ILL 1. 2. 3. 2.
ILR 1. 3. 1. 1.
H 5. 5. 4. 4.
BL 5. 6. 5. 6.
BR 6. 6. 5. 7.
UN 0.144 0.175 0.092 0.207

Sequences

Field Description
UTR seq + 25 auaacgguccccgccggagugaggcgaggccgcgucgcucaguucuggccgucuagggccccuguaaggaugagagcgcagaggacgcagggccgcuggaggcgcagguaacgaagcuagggugcgguugggaccgcggcugagcuuuuuccgggacccguggugcugaATGAGGTTCCGCATCTACAAACGGA
UTR dot + 25 ….((((….))))((((((.(((….))).))))))…(((((((.(((((((.((((((…..((……))……)))))))).)))))))).))))….((((((.((.((((((….)))))).)).))))))…((((((((((……..))).)))))))…………..
RS 1 seq GUUUUCCUUCGGGGUUGGGUGAAAUUCCCUACCGGCGGUGAUCGCAUGGCGGCGGCGGAAAAGCAUGCCGAGCAUUGCGUCAGUCCGUGACCCGGUUCUGUUCGGAGCAUGCCCUUACGGUCAUGCGCGGCGGAAACGGUGGACCUGGUGAAAUUCCGGGACCGACAGUAUAGUCUGGAUGGGAGAAGGAAACG
RS 1 dot …………(((.(((…….))).))).(((((((.((((((.(((((((……)).)))))..))).))))))..))))…(((..((((.(((..(((((.((….)).))))).)))))))..)))(((.(((((…….))))).))).(((……)))……………..
RS 2 seq CUACGGUGGACGCGCCGUGGUGUUCGGGAAGCCGGUGCACUGUGCUCGUCACAGGAGUCCGGAGCGGCCCUCGCCACUGUGAUCGGGGAGCCGUCGGCUCCCACCUCGUGCCACUGGCCGUUCGCGGCCGGGAAGGCCGGGCGCCGACGCCGAACACCCCGUCAGCCAGGAGACCGGCCACGGCAUCUCACGAAGU
RS 2 dot ..((((((….))))))(((((((((…((((((((((.(((………((((.(((..((((((((((……….))))).)))))))))))))))…)))).))))))((((.(((.((((…..)))).))).)))))))))))))((((..(((.((…))))).))))………….
RS 3 seq AAAUUGAAUAAGACGGAAGGUGCUUGUGGGCCUCGAUGCUGCACAAGUGAAAAGGGAAGCAGGUGUGAAUCCUGCACGAUCUCGUCACCGUAUUUCAAGAGUUUCCUUCAUAUGCCACUGGAUGAUCCGGGAAGGCGAAGGAAGCGCUAAAGAAUUGAUAAGCCGGGAGACCUGCCUGUCGUCGUACAUGGGU
RS 3 dot …………………((((((((((……))).)))))))…..((((.((.((((((((((……))).))).)))))).)))).((.(((((((((….(((.(((((…)))))…)))))))))))).))…((..(((((.((.((….)).)).)))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table