Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA065734 Similarity: 0.986 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA065734
Gene: MGST3
MFE: -12.725
ENS: 0.824
Length: 72.
Predicted Ligands:
fluoride - 11/20
guanidine - 2/20
aminoglycoside - 2/20
 RS: URS00021EE188_12908
MFE: -26.575
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
 RS: URS0000D911FE_1798575
MFE: -12.409
Ligand: fluoride
Species: Lentisphaerae bacterium GWF2_52_8 Fluoride riboswitch
 RS: URS0000E5FA5C_1484158
MFE: -12.092
Ligand: aminoglycoside
Species: Pantoea sp. PSNIH1 putative aminoglycoside riboswitch / attI site
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA065734 URS00021EE188_12908 URS0000D911FE_1798575 URS0000E5FA5C_1484158
Length 72. 71. 71. 71.
Similarity - 0.986 0.986 0.986
Ensemble Norm 0.824 - - -
MFE -12.725 -26.575 -12.409 -12.092
Ligands - guanidine fluoride aminoglycoside
Gene MGST3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 5.001 3.
Length SE - 1. 1. 1.
Lev Distance - 16. 16. 17.
UBS 3. 2. 4. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 2.
ILR 1. 0. 2. 2.
H 1. 1. 1. 1.
BL 1. 1. 0. 0.
BR 0. 1. 1. 0.
UN 0.375 0.324 0.338 0.366

Sequences

Field Description
UTR seq + 25 uacauaauagcgucgggggcaaguaaguguggaagacgagacgcaagATGGCTGTCCTCTCTAAGGAATATG
UTR dot + 25 …………..((((((.(((…((((……….))))…..)))))))))………….
RS 1 seq UAAUCGUUGCCACCGGGCAGUUAAUCACUUCAUUAGGUCAAAGAAGAAGUGAUUGGCUGUCCUUUUUUUGU
RS 1 dot …………..(((((((((((((((((.((……..)).)))))))))))))))))………
RS 2 seq AAAUAAAAAGGCUAUGAGGUCAGCCGAAACCGUCUGAGCGAAGAACUCGGAAUGAUGACUUCUAUUUAGGG
RS 2 dot ……………(((((((..((…((((((……)))…)))..)).)))))))………
RS 3 seq GGAGCAGCAACGAUGUUACGCAGCAGGGCAGUCGCCCUAAAACAAAGUUAGGCAUCACAAAGUACAGCAUC
RS 3 dot ………..((((((..((…(((((….)))))……..))..))))))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table