Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA065735 Similarity: 0.989 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA065735
Gene: MGST3_0
MFE: -10.575
ENS: 0.885
Length: 53.
Predicted Ligands:
unknown - 10/20
glutamine - 8/20
TPP - 1/20
 RS: URS0000D6ADE4_392499
MFE: -27.126
Ligand: unknown
Species: Sphingomonas wittichii RW1 sul1 RNA
 RS: URS0000E5FBD5_1206458
MFE: -29.026
Ligand: unknown
Species: Novosphingobium sp. MBES04 sul1 RNA
 RS: URS0000E6047F_1234595
MFE: -29.026
Ligand: unknown
Species: Pacificimonas flava sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA065735 URS0000D6ADE4_392499 URS0000E5FBD5_1206458 URS0000E6047F_1234595
Length 53. 54. 54. 54.
Similarity - 0.989 0.989 0.989
Ensemble Norm 0.885 - - -
MFE -10.575 -27.126 -29.026 -29.026
Ligands - unknown unknown unknown
Gene MGST3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.072 1.072 1.072
Length SE - 1. 1. 1.
Lev Distance - 13. 13. 13.
UBS 2. 2. 2. 2.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 0. 1. 1. 1.
H 1. 1. 1. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.491 0.222 0.222 0.222

Sequences

Field Description
UTR seq + 25 acauaauagcgucgggggcaaacgcaagATGGCTGTCCTCTCTAAGGAATATG
UTR dot + 25 ………….(((((((…((……)))))))))………….
RS 1 seq GUCGGACCCGGCCGUGCCGGGUGGCUCGGCCCGGCGCCUAUCCCCGGGACAACC
RS 1 dot ……(((((..(((((((((……)))))))))……)))))……
RS 2 seq AUCGGACCCGGCCGCGCCGGGUGGCUCGGCCCGGCGCCUAUCCCCGGGACAACC
RS 2 dot ……(((((..(((((((((……)))))))))……)))))……
RS 3 seq AUCGGACCCGGCAGCGCCGGGUGGCUCGGCCCGGCGCCUAUCCCCGGGACAACC
RS 3 dot ……(((((..(((((((((……)))))))))……)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table