Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA065945 Similarity: 0.982 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA065945
Gene: MIOS
MFE: -14.171
ENS: 0.970
Length: 85.
Predicted Ligands:
cyclic-di-GMP - 8/20
GMP - 7/20
zmp-ztp - 3/20
 RS: URS0000D663DB_12908
MFE: -27.846
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000D66908_12908
MFE: -37.396
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000C3406B_1734399
MFE: -26.677
Ligand: cyclic-di-GMP
Species: Clostridia bacterium BRH_c25 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA065945 URS0000D663DB_12908 URS0000D66908_12908 URS0000C3406B_1734399
Length 85. 85. 85. 84.
Similarity - 0.982 0.982 0.981
Ensemble Norm 0.970 - - -
MFE -14.171 -27.846 -37.396 -26.677
Ligands - GMP GMP cyclic-di-GMP
Gene MIOS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.005 8.007 6.007
Length SE - 0. 0. 1.
Lev Distance - 21. 22. 22.
UBS 6. 7. 5. 5.
BS 0. 0. 0. 0.
ILL 4. 2. 2. 2.
ILR 3. 3. 2. 3.
H 1. 1. 1. 1.
BL 1. 3. 2. 0.
BR 1. 1. 2. 1.
UN 0.212 0.141 0.129 0.131

Sequences

Field Description
UTR seq + 25 cgcucucguaauuugccacgugaauggaccugaguggacccuuugaucacaucaguaaacATGAGCGGTACCAAACCTGATATTT
UTR dot + 25 (((((..((…((((…((((..((.((…..)).))……))))….))))))..)))))………………
RS 1 seq CGGUUGGGUGGGUCCAUCGACCGUCGUGGCGUAUUCGGACGCUUUACCACGACGCGAGGAAAUAGCGAGACCGACCACCCCCUUU
RS 1 dot (((((.(.((..(((.(((..(((((((((((……))))…..)))))))))))))..)).)..)))))…………
RS 2 seq CGGUCAGCGGGAAGCUCUGACGCGCGGUCCAAAACCCUGGCCGCCCGGACCGCGCCGAGCCACUGGCGAGACCGACCCGCGAUGG
RS 2 dot (((((.((.((..((((….(((((((((…………….))))))))).))))..)).))..)))))………..
RS 3 seq UUGGUUGCAGGGGGCUAGGACUUGCGACCUAUACUUGGGCACCUGGAUCGCAACGAGCUGGUGGUGCAACCGACCUGACAUUGU
RS 3 dot (((((((((….(((((..(((((((((((….))))……..)))))).)..)))))..)))))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table