Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066112 Similarity: 0.944 Similarity: 0.942 Similarity: 0.940
UTR: 5HSAA066112
Gene: MLF1
MFE: -68.332
ENS: 0.872
Length: 194.
Predicted Ligands:
cobalamin - 10/20
lysine - 3/20
TPP - 2/20
 RS: URS0002335854_1230466
MFE: -68.137
Ligand: cobalamin
Species: Pseudomonas fluorescens ABAC62 Cobalamin riboswitch
 RS: URS0002316B15_1622118
MFE: -33.860
Ligand: cobalamin
Species: Lutibacter profundi Cobalamin riboswitch
 RS: URS00002DE5C7_1231072
MFE: -34.469
Ligand: cobalamin
Species: Clostridium tetani 12124569 Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066112 URS0002335854_1230466 URS0002316B15_1622118 URS00002DE5C7_1231072
Length 194. 195. 192. 193.
Similarity - 0.944 0.942 0.940
Ensemble Norm 0.872 - - -
MFE -68.332 -68.137 -33.860 -34.469
Ligands - cobalamin cobalamin cobalamin
Gene MLF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 35.001 33. 24.
Length SE - 1. 4. 1.
Lev Distance - 57. 56. 68.
UBS 11. 11. 15. 8.
BS 2. 0. 0. 3.
ILL 0. 2. 2. 2.
ILR 2. 2. 4. 3.
H 3. 4. 3. 3.
BL 6. 1. 7. 3.
BR 3. 2. 5. 3.
UN 0.113 0.149 0.115 0.098

Sequences

Field Description
UTR seq + 25 aaugggaaagcagcucggugucacgcaccuccuaucccggcgggcaccgccugcgccgcggcgagugaggcgucguccguacuggaggcuagcucuugucgcggccgcggcgaguuaacaucguuuuuccaaucuguccgcggcugccgccacccaagacagagccagaATGCGACAGATGATAAGAAGTTTTT
UTR dot + 25 ..((((((((((((((((((((.(((………….)))))))))(((.(((((((((((((.(.(((.((……….)).)))..).))))))))))).))))))))))……)))))))))((((((.(((((((……………..))))…..)))))))))…………..
RS 1 seq CAACUACCAUACCGCGCCGGUUCCCAAACGGGACUAAAAGGGAAUCCGAAGCGCGGUACCCUCGCGUCAAUCGGAACUGCCCCCGCAACUGUAGGUGCUGAGCCUGCUCCUUGAUGCCACUGGACUUUGUCCGGGAAGGCCGGAGCCUGGCGACGACGCAUCAGUCAGGAGACCUGCCGGCUCAAGCUCAAUUAC
RS 1 dot ………((((((((((((((((…………..))))).)))..))))))))…..(((((((..(((……………((((((…..))))))))))))))))(.((((((…)))))))..((((((((((((((…………))))))….)).))))))………….
RS 2 seq AAUUUUAUCGUACGAAGAGGUUUUACUUAAUUGUAGAUUAAUAGGGAAUCUGGUGUAAAUCCAGAGCUGUCGCGCAACUGUAAGUAACAUUCAAAAGAUUUUUAUCCUAGUGUUCCACUGUUUUUAAUGAAAAUGGGAAGGACGAUAAAAACUGUUAUAAGUCAGGAGACCUGCCCUUUUCGAUAUGACUUU
RS 2 dot ……(((.(((((.(((……)))..)))))))).((((((((((((((.(((((((..(((.(((.((……….)).))))))….))))..))).)))).))))).)))))…..((((((.(((.(((………(((……)))…….))).)))))))))……….
RS 3 seq AUAUUGAAAUAAUAAAUAGUUUUAAAAUAAUAAUUAUUAUUUUAAAUAAUAGGGAAGCAGGUGAGAAUCAUGCACGGUCCCGCCGCUGUAAUGGGGAACUUUUUCAAAAUAAGCCACUAGAUUUUAUUUCUGGCAAGGUUUAAAAAAGUAAUGAACCUAAGUCAGAACACCUGCCUAUAUUAAAUGCACUAUA
RS 3 dot …((((((((((((.((…………)).)))))))))))).(((((.((..(((((((((((((..(…((((((…………)))…………….))).)..))))))..(((((((.(((((((………)))))))..)))))))))))))))).)))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table