Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066134 Similarity: 0.950 Similarity: 0.944 Similarity: 0.942
UTR: 5HSAA066134
Gene: MLH1
MFE: -45.678
ENS: 0.856
Length: 193.
Predicted Ligands:
cobalamin - 15/20
lysine - 2/20
TPP - 1/20
 RS: URS0002312CDE_1914540
MFE: -37.989
Ligand: cobalamin
Species: Bacillus obstructivus Cobalamin riboswitch
 RS: URS000231A6C5_438753
MFE: -74.979
Ligand: cobalamin
Species: Azorhizobium caulinodans ORS 571 Cobalamin riboswitch
 RS: URS0000C39394_1524831
MFE: -72.074
Ligand: TPP
Species: Pseudogymnoascus sp. 23342-1-I1 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066134 URS0002312CDE_1914540 URS000231A6C5_438753 URS0000C39394_1524831
Length 193. 193. 194. 194.
Similarity - 0.950 0.944 0.942
Ensemble Norm 0.856 - - -
MFE -45.678 -37.989 -74.979 -72.074
Ligands - cobalamin cobalamin TPP
Gene MLH1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 4.004 7.003
Length SE - 0. 1. 1.
Lev Distance - 61. 72. 72.
UBS 14. 15. 14. 13.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 4.
ILR 6. 5. 5. 5.
H 3. 2. 4. 2.
BL 6. 7. 6. 6.
BR 5. 7. 4. 5.
UN 0.073 0.093 0.139 0.129

Sequences

Field Description
UTR seq + 25 cuuuuccgcagaccguguguuucuuuaccgcucucccccgagaccuuuuaaggguuguuuggaguguaaguggaggaauauacguaguguugucuuaaugguaccguuaacuaaguaaggaagccacuuaauuuaaaauuauguaugcagaacaugcgaaguuaaaagATGAATGGTTACATATCCAATGCAA
UTR dot + 25 …….(((((((((((((((((((((.((.((((…..((((((…))))))….)))).))..)))))))))))))))..)).)))).((((((….))))))….(((.((((((((.(((.(((..((((.((((((…..)))))).))))..))).))).)))))…..)))..)))..
RS 1 seq GAAUACCUGCAGGGAAUAGGUUGCUAAGAUAUUAGCAUUAAUAGGGAAUUCGGUGUGAUACCGAAGCUGUUUCCGCAACUGUAAGUGCCGAUGAAAUAAGAAGCAAACCACUGUUUGCAACAUCGAAAACGGGAAGGUUCUUAAAGUAAAAUGACGCACAAGCCAGGAGACCUGCCUAUUCUUGAACGUAACA
RS 1 dot …….((((((.(…(((((((….((((.(((((.(((((((((((((((…)))))))…..))))….)))).))))).))))……..))))).))..).))))))…((((.((.(((.(((.((((…((…………..))…))))))).))).)).))))……..
RS 2 seq CUAAGGUGUCAUCGGGAAGGUGCGGCCCUUUGGGGCCGUGAAAAGGGAAUCCGGUGCGGCCACAAGGCCCAGGCCGGAGCUGCCCCCGCAACUGUAAGCGGCCGAAGACGCGAUCCUCAUGCCACGGGCACGCCCCGGAAGGCGAUCGCGGACAGGACGCGAGCCAGGAGACCUGCCUUCUCGCAACUGAACUC
RS 2 dot ………….(((.((.(.((((((((((.((((((…..((….))…)))))).)))))….))))).).)).)))((((……..))))…….(((((((…..(((.((((…..))))…))))))))))..(((…(((((.((((…))))….)))))..)))…..
RS 3 seq UAAUAGCAUGACGGGUGUCCAGGUCCUCAAUUGUUUCUUUCAGCUCAGUCUAGCUCUGGAGAUUGUGGUCUCACGACCCUCUCUUCAUCGCGAGUCAGAGCUGGAUGAGGCAAUUGAAGACCUGGUUCUGAGAUUAUACCGUAUGAACUUGAUCUAGACAAUUCUAGCGCAUAAGGACAUGCUUCCCCUCCCCU
RS 3 dot ………….((((((((((((.(((((((((((.((((((((.(.((.((..((((((..(.((((….)))))..))))))..)).)).).)))))))).))))))))))).)))))))……….)))))(((((..((((..(((((….)))))….))))..)))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table