Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066409 Similarity: 0.948 Similarity: 0.948 Similarity: 0.943
UTR: 5HSAA066409
Gene: MLLT10
MFE: -41.762
ENS: 0.770
Length: 190.
Predicted Ligands:
glucosamine - 9/20
cobalamin - 9/20
Mg2+ - 1/20
RS: URS0000BEF205_1263065
MFE: -60.712
Ligand: glucosamine
Species: Clostridium clostridioforme CAG:132 glmS glucosamine-6-phosphate activated ribozyme
RS: URS0000C86A62_1834196
MFE: -60.712
Ligand: glucosamine
Species: Lachnoclostridium sp. YL32 glmS glucosamine-6-phosphate activated ribozyme
RS: URS000232B354_1122184
MFE: -45.412
Ligand: cobalamin
Species: Lutispora thermophila DSM 19022 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066409 URS0000BEF205_1263065 URS0000C86A62_1834196 URS000232B354_1122184
Length 190. 191. 191. 191.
Similarity - 0.948 0.948 0.943
Ensemble Norm 0.770 - - -
MFE -41.762 -60.712 -60.712 -45.412
Ligands - glucosamine glucosamine cobalamin
Gene MLLT10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 3. 11.010
Length SE - 1. 1. 1.
Lev Distance - 67. 67. 70.
UBS 11. 12. 12. 12.
BS 0. 0. 0. 0.
ILL 4. 5. 5. 3.
ILR 2. 2. 2. 2.
H 4. 4. 4. 4.
BL 2. 2. 2. 5.
BR 4. 3. 3. 4.
UN 0. 0.079 0.079 0.199

Sequences

Field Description
UTR seq + 25 agcuugcagcaacgugcucugcaacuuaauccuacgcuaaaagagggcagagagcgaaaaagaauggaauacaaacucucccgacauccguaguuacuuucaagguggauuguguauuuuaaggcugaugggaacgucugguuuguggagcaaaaagaagagaagATGGTCTCTAGCGACCGGCCCGTGT
UTR dot + 25 .(((…)))..(((.((((((..(((……………))).)))))).)))……..(((((((((…(((.((…………………)).)))…)))))))))……(((((…..((((((..((((((……………..).)))))..)))))))))))..
RS 1 seq UAGCAAAGCUAAGCGCCAUGCACCUUUUACCGGGGACGUGAACAGCAGGAAGGUCUGCUGCCGGUGGAAAGGUUAACGAGGUGGAGAGAGAAUCGAGAAAUUCGGCGGGUGCUCUCCCAUGCUGUCCGGGCGUGUUACAUACUGGAAAAUAUGCGGGUAACUGCAAAACAAAGCCAGCGUGACCGGAUGAA
RS 1 dot ..(((..((…..))..)))((((((((((((………(((((((….))))))))))))).))))))…….((((.(((((.(((………….))).)))))))))…((((((…..((((…((((……(((((….)))))……..)))).))))))))))…
RS 2 seq UAGCAAAGCUAAGCGCCAUGCACCUUUUACCGGGGACGUGAACAGCAGGAAGGUCUGCUGCCGGUGGAAAGGUUAACGAGGUGGAGAGAGAAUCGAGAAAUUCGGCGGGUGCUCUCCCAUGCUGUCCGGGCGUGUUACAUACUGGAAAAUAUGCGGGUAACUGCAAAACAAAGCCAGCGUGACCGGAUGUA
RS 2 dot ..(((..((…..))..)))((((((((((((………(((((((….))))))))))))).))))))…….((((.(((((.(((………….))).)))))))))…((((((…..((((…((((……(((((….)))))……..)))).))))))))))…
RS 3 seq CUCAAUAGAAUAAGUUUUGGUGCCUUGGGAUAUUAUACGUACCGAGGUUAAAAGGGAAAGCAGUGAGAAGCUGCUGCAGCCCCCGCUACUGUAUAUGGGGAUGAAAUCCAACUUAGCCAUUGGGAGACCGAGAAGGCUGGAGAGUAAGAUGAACCAUGAGCCAGGAAACCUGCCAAAUGCUAUGUUCAACC
RS 3 dot …………..(((((..(((((((………….))))))))))))…..((((((…..))))))…..(((((……….)))))………(((.((((..((((.((……..((((.(.(.((…….))).).))))…….)).))))..)))).)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table