Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066626 Similarity: 0.955 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA066626
Gene: MMACHC
MFE: -53.656
ENS: 0.857
Length: 174.
Predicted Ligands:
cobalamin - 8/20
lysine - 4/20
molybdenum - 3/20
 RS: URS0000AB3102_233412
MFE: -43.974
Ligand: molybdenum
Species: Haemophilus ducreyi 35000HP Moco (molybdenum cofactor) riboswitch
 RS: URS000231FC06_1592326
MFE: -69.060
Ligand: cobalamin
Species: Actinobacteria bacterium OK006 Cobalamin riboswitch
 RS: URS000232238B_1123243
MFE: -55.640
Ligand: cobalamin
Species: Schwartzia succinivorans DSM 10502 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066626 URS0000AB3102_233412 URS000231FC06_1592326 URS000232238B_1123243
Length 174. 173. 174. 174.
Similarity - 0.955 0.951 0.951
Ensemble Norm 0.857 - - -
MFE -53.656 -43.974 -69.060 -55.640
Ligands - molybdenum cobalamin cobalamin
Gene MMACHC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.012 8.002 1.021
Length SE - 1. 0. 0.
Lev Distance - 57. 62. 66.
UBS 11. 10. 11. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 4. 2.
ILR 2. 1. 4. 2.
H 5. 4. 4. 5.
BL 3. 3. 2. 3.
BR 3. 3. 2. 3.
UN 0.080 0.191 0.034 0.224

Sequences

Field Description
UTR seq + 25 aucccaagaugcaucgcgcauaggcaauauggucccgcuacuggacccauuuccuaccugggaaauggagucgaagcugacucaaaacguaacggcccaauuguccuugagacuucauuccccagcaagcucagcguguaacgugcgcuATGTTTGACCGGGCCCTCAAGCCCT
UTR dot + 25 ………(((…..)))((((.(((..(((((…….))))).))).)))).(((((.(((((((((.(((..(((…………………))))))..))))))))).)))))(((((..(((((…….)))))..)))))…((((……)))).
RS 1 seq UAACUUAAACGAUACCGAGCUUGUUAGCCUAAGUCUAUUGAUAAGGCAGCAAAGCCUGCAAUAUAAGCGGUCGAGUUGAUGAAAUAUUUAGCUAUUAAUCGCUUAUUUUGCACAGGAUAGUAAAGAAAUGCACUAUCCUCUCAUAUUCAGAAAGGUGUCAAAUUUUCAUUCAC
RS 1 dot …………….(.(((((((.((((..(((….))).))))))))).)))(((((.(((((((((..((((((……..))))))….))))))))).))))).((((((((……….))))))))……….(((((……..)))))……
RS 2 seq CUCCUGAGGAAUACCCGCGGUGCAGGGAAGCCGGUGUGAAACCGGCACGGUCCCGCCACUGUGACCGGGGAGUACGUCGUCGAGCAGGACGCCACUGACGAGCGAGAUGUCGGGAAGGCGGACGGCGCGCGCUGAUCCGGGAGUCAGGAUACCGGCCGCGGUUUUGUUCCGUGU
RS 2 dot (((((..((……(((((((..((((.((((((…..))))))….))))..))))))).)).)))))..(((((((……..((((.((((((…….))))))…)))))))))))…((((((((……..))))..))))(((((…….))))).
RS 3 seq CGGAAUAGCGUGGGGAAAGGUGCCGAACGGCACAAUAGGGAAUCCGGAAAUCCGGAGCGGUCCCGCCACUGUAAUGGGGAGCCCUCACCAGCAUGCCACUGAAUACAGCUUUCGGGAAGGCGGUGAGAGGCGAUGAGCCUAAGCCAGGAUACCUGCCUUUCUCAACAAUCACCG
RS 3 dot ……………….(((((….)))))….((((.(((((….)))))….)))).(((……)))…(((((((((…..(((.(((((…….)))))…))))))))).)))..((((…(((.((((…)))).))).))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table