Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066632 Similarity: 0.958 Similarity: 0.957 Similarity: 0.956
UTR: 5HSAA066632
Gene: MMADHC
MFE: -44.406
ENS: 0.852
Length: 144.
Predicted Ligands:
cobalamin - 10/20
FMN - 4/20
TPP - 3/20
 RS: URS0000D9FA76_518642
MFE: -58.314
Ligand: TPP
Species: Streptomyces nanshensis TPP riboswitch (THI element)
 RS: URS0000D87F06_1972458
MFE: -29.177
Ligand: glycine
Species: Candidatus Atribacteria bacterium 4572_76 Glycine riboswitch
 RS: URS000231F858_1232683
MFE: -45.983
Ligand: cobalamin
Species: Marinobacterium sp. AK27 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066632 URS0000D9FA76_518642 URS0000D87F06_1972458 URS000231F858_1232683
Length 144. 143. 145. 144.
Similarity - 0.958 0.957 0.956
Ensemble Norm 0.852 - - -
MFE -44.406 -58.314 -29.177 -45.983
Ligands - TPP glycine cobalamin
Gene MMADHC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 15.030 16.005
Length SE - 1. 1. 0.
Lev Distance - 49. 49. 51.
UBS 12. 12. 9. 11.
BS 0. 0. 0. 0.
ILL 1. 4. 1. 3.
ILR 3. 3. 2. 2.
H 5. 4. 4. 5.
BL 3. 4. 3. 2.
BR 4. 3. 2. 1.
UN 0.083 0.091 0.255 0.153

Sequences

Field Description
UTR seq + 25 uugcgcgugcgcaucaucguuucgacgcgcucggaagcaacuuccuuugccugcucaccgccagcguaggugcuaccaccgcugccgucgccgccgccauuuugauggcaggaagagucATGGCCAATGTGCTTTGTAACAGAG
UTR dot + 25 ..(((((((((……)))….))))))..(((((…)))))…((((((.(…….).))))))…..(((….(((((.(((.(((((((….))))).))..).)).)))))….)))(((((…)))))
RS 1 seq UUUGCACACCGCGGGAGCUCCGAGCACGGGGCUGAGAGGGCGCUGACCUCCGUACACCGGUCAACCGGCCACGGAGAACGCUGCGUCGACCGCCGAACCUGGUACCGGGUAAUGCCGGCGUAGGGAGUUGGUCGCAUGACCAU
RS 1 dot …((.(.((.(…(((((((….)))))))..).))).))….((((((…((((….))))..))))))..(.((((((((…((…(((((….)))))…)))))))))).)…(((((….))))).
RS 2 seq UGAUAGAACUCUGGAGAGAUUUAUACAAAAAAGCACCGAAGGGGCAAUUCCUAAUCGUUAGGAGAUCUAUACAGAAUUUACCAAAAGAAAUACUUUCUAUUUUUAUGGGAAGAAUCUUUCAGGUAAAAAGGACAGAGUAAAGAAG
RS 2 dot (((((((.(((….))).))))).))…..((.((….))))..(((((((…)))))))…………((((((.(((((….((((((((….))))))))..)))))..))))))………………
RS 3 seq UCGCCCUCUGACCGCAAGGGUGCCCGGAAUAGCCGGGAUAAUCGGGAAGUUGGUUGAAAUCCAACGCUGCCCCCGCAACGGUGAUGGACGCUGUAAACACAGUGCAUCCUAAGCCCGGAGACCGGCCCUGCUGACGCCCAUAGA
RS 3 dot .((((((.((….))))))))(((((…..)))))……(((.(((..((((…..))))))).)))(((….(((…(((((((((….))))))..)))…))))))….((((…))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table