Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066727 Similarity: 0.986 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA066727
Gene: MMP7
MFE: -15.993
ENS: 0.794
Length: 72.
Predicted Ligands:
2'-dG-II - 4/20
purine - 4/20
cobalamin - 3/20
 RS: URS0002317B63_1262759
MFE: -8.529
Ligand: cobalamin
Species: Brachyspira sp. CAG:484 AdoCbl variant RNA
 RS: URS0000D6BC3C_12908
MFE: -18.832
Ligand: 2'-dG-II
Species: unclassified sequences 2'dG-II riboswitch
 RS: URS0000D6B12F_12908
MFE: -22.182
Ligand: 2'-dG-II
Species: unclassified sequences 2'dG-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066727 URS0002317B63_1262759 URS0000D6BC3C_12908 URS0000D6B12F_12908
Length 72. 73. 71. 71.
Similarity - 0.986 0.985 0.985
Ensemble Norm 0.794 - - -
MFE -15.993 -8.529 -18.832 -22.182
Ligands - cobalamin 2’-dG-II 2’-dG-II
Gene MMP7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.006 4.009 4.009
Length SE - 1. 1. 1.
Lev Distance - 17. 18. 18.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 0. 0. 1. 1.
H 2. 2. 2. 2.
BL 0. 1. 1. 1.
BR 1. 2. 0. 0.
UN 0.319 0.397 0.225 0.225

Sequences

Field Description
UTR seq + 25 accaaaucaaccauagguccaagaacaauugucucuggacggcagcuATGCGACTCACCGTGCTGTGTGCTG
UTR dot + 25 …………….((((((((…….))).))))).(((((…(((……))))))))……
RS 1 seq AUUUUUAUAAGAGGAAAUUGAUGUGCAACUCAUCAGCUGUGCCGCAACCGUAAAAGCCGGAACACUCAGAAAA
RS 1 dot ………………(((((…….)))))..(((.((((……….)).)).)))………
RS 2 seq UAUCCUUAUAAUCUAGCUGAUUGGCGCUAGAGUAUCCACGACCGGACCUUAAUCCGGUGUAUCCAGGGAAA
RS 2 dot ………..((((((……..))))))…(((((.((((((……))))))))……)))..
RS 3 seq UGUCCUUGUAAUUUGGGGGAUUGGCCCCAGAGUAUCCACGAUCCGGCCGUAACCGGAUGUAUCCAGGGAAA
RS 3 dot ………..(((((((……)))))))…(((((.((((((……))))))))……)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table