Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066728 Similarity: 0.988 Similarity: 0.985 Similarity: 0.983
UTR: 5HSAA066728
Gene: MMP7_0
MFE: -15.993
ENS: 0.
Length: 77.
Predicted Ligands:
cobalamin - 9/20
fluoride - 5/20
Ni/Co - 3/20
 RS: URS0002333667_1618461
MFE: -11.026
Ligand: cobalamin
Species: Candidatus Levybacteria bacterium GW2011_GWB1_35_5 AdoCbl variant RNA
 RS: URS0000D68389_12908
MFE: -19.946
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
 RS: URS0000C0803E_1736541
MFE: -31.321
Ligand: homocysteine
Species: Variovorax sp. Root473 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066728 URS0002333667_1618461 URS0000D68389_12908 URS0000C0803E_1736541
Length 77. 77. 76. 76.
Similarity - 0.988 0.985 0.983
Ensemble Norm 0. - - -
MFE -15.993 -11.026 -19.946 -31.321
Ligands - cobalamin Ni/Co homocysteine
Gene MMP7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.003 3.001 2.054
Length SE - 0. 1. 1.
Lev Distance - 16. 18. 21.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 1.
ILR 0. 0. 0. 0.
H 2. 2. 2. 3.
BL 0. 1. 1. 0.
BR 1. 1. 2. 0.
UN 0.364 0.416 0.395 0.132

Sequences

Field Description
UTR seq + 25 aaaacaccaaaucaaccauagguccaagaacaauugucucuggacggcagcuATGCGACTCACCGTGCTGTGTGCTG
UTR dot + 25 …………………((((((((…….))).))))).(((((…(((……))))))))……
RS 1 seq AGAGAAUAAUUUUUAGGGUGAAGUAGGUGAAACUCCUACGCUGUGCCGCAACUGUUAAAGUCAGAGCCCCGUUCCCU
RS 1 dot ………………….(((((…….)))))(((.((…..(((…..))))).)))……….
RS 2 seq UAUAUUUGCAAGGAACAGGCGCCUAGUUACUAGGUAGCCGGGCGUAAUGCAGCAGAGUAAUGCCUGUGGGACCAUC
RS 2 dot ………………((((((.(((((…))))).))))))…((((((……))).)))………
RS 3 seq CUUCCCAAGGAGCGUUGCAGCGGUUCGCCACAGAGGCGAAUCGUCAGGCUUGGGGCGACAACGACGCUCGCCUGUU
RS 3 dot .((((…))))…….((((((((((…..))))))))))(((((…(((((…….))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table