Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066882 Similarity: 0.982 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA066882
Gene: MORC1
MFE: -34.429
ENS: 0.830
Length: 87.
Predicted Ligands:
glycine - 13/20
GMP - 3/20
cyclic-di-GMP - 2/20
 RS: URS0000D6C8DB_12908
MFE: -31.038
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000D69660_12908
MFE: -19.466
Ligand: cyclic-di-GMP
Species: unclassified sequences Cyclic di-GMP-II riboswitch
 RS: URS0000C1C2D3_1641875
MFE: -25.051
Ligand: glycine
Species: Roseovarius atlanticus Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066882 URS0000D6C8DB_12908 URS0000D69660_12908 URS0000C1C2D3_1641875
Length 87. 88. 85. 87.
Similarity - 0.982 0.982 0.981
Ensemble Norm 0.830 - - -
MFE -34.429 -31.038 -19.466 -25.051
Ligands - GMP cyclic-di-GMP glycine
Gene MORC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.008 3.002 6.002
Length SE - 1. 4. 0.
Lev Distance - 22. 19. 23.
UBS 8. 7. 8. 9.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 4.
ILR 1. 1. 2. 3.
H 1. 1. 1. 1.
BL 3. 3. 4. 3.
BR 2. 3. 2. 3.
UN 0.023 0.114 0.071 0.069

Sequences

Field Description
UTR seq + 25 ggcgaacggcugccggucagguguccuuguccccuugaguugcgcgggucguguucgagggcATGGACGACAGGTACCCTGCGCTTC
UTR dot + 25 ((((…((.((((.(((….((((.((..(((((((…(((((…)))))))))))))).))))))).))))))…))))..
RS 1 seq AAUCUUGCUUGACGCAUUGAUCCGCCAGUCUCUAUUCGGGCGUCAUGAGACGGUGGGGAGCGGAGUGACGCGACCGGCAAGCGACAAG
RS 1 dot …((((((.(.(((.((..(((((…(((((((…..((((….))))))))))))))))..)).))).).))))))…….
RS 2 seq UGAAAUAUUGGAGGCGAUGAAGGUGAGACUGUAUUUGGACGCUUGGUCUUACCGGGAGCCAGUAGCGUAACCUGCCAGUUAGUAA
RS 2 dot …..((((((.(((…..((((…((..((.((((.(.((((((…)))))).)))))))..)).)))))))..)))))).
RS 3 seq AAGUAUCGGAACGGGAGAACCGGCGUUGCCGGUGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCGCAAGGACCGACCGAUGGAC
RS 3 dot …((((((..(((…..((.((((((..(((.(((..((.((….)))))))..)))..))).)))..)).))).))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table