Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066968 Similarity: 0.973 Similarity: 0.973 Similarity: 0.971
UTR: 5HSAA066968
Gene: MOSPD2
MFE: -35.038
ENS: 1.
Length: 113.
Predicted Ligands:
TPP - 7/20
glycine - 4/20
SAM - 4/20
 RS: URS0000DA9597_1903686
MFE: -19.672
Ligand: TPP
Species: Jeotgalibaca sp. PTS2502 TPP riboswitch (THI element)
 RS: URS0000C5DD5C_1069530
MFE: -38.222
Ligand: glycine
Species: Candidatus Burkholderia schumannianae Glycine riboswitch
 RS: URS0000AB8FE1_269796
MFE: -45.185
Ligand: glycine
Species: Rhodospirillum rubrum ATCC 11170 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066968 URS0000DA9597_1903686 URS0000C5DD5C_1069530 URS0000AB8FE1_269796
Length 113. 112. 112. 112.
Similarity - 0.973 0.973 0.971
Ensemble Norm 1. - - -
MFE -35.038 -19.672 -38.222 -45.185
Ligands - TPP glycine glycine
Gene MOSPD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2.001 10.
Length SE - 1. 1. 1.
Lev Distance - 35. 35. 33.
UBS 9. 10. 10. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 2.
ILR 3. 3. 3. 5.
H 1. 1. 1. 1.
BL 5. 5. 5. 4.
BR 4. 5. 4. 2.
UN 0.053 0.062 0.018 0.071

Sequences

Field Description
UTR seq + 25 gggcgggacugccgggugaugagauacucggucggcgacgguagaacgggcgacggcgacaaccgcaaucacauccacgacggugaucATGGCAGAGAATCACGCCCAGAATA
UTR dot + 25 (((((.((((((((((((.(((……..((((.((.((.(……).)).)).))))……..))))))))…………..)))))….)).)))))……
RS 1 seq AUUAAGCACUGGGAGCGCUGAGUAGUUCAGCUGAGAGAAAGAUACGAUUACAUCUUUGAUCCCUAUACCUGAUCUAGAUAAUACUAGCGUAGGAAAGUGUAUAAUAUUAAGC
RS 1 dot ((((.(((((….(((((.(((((.((((.((((.(((((((……..)))))…)).)).)).)))).))…….))))))))…..))))).))))…….
RS 2 seq CUGCACGCGUCGGGAGAGCGCGUGGUUGCCGCUUGGCUCGACCAAAGCGAACACCGCGCCGCCGAAGGCAGCAUACCCGCAAACUCUCAGGCAAAGGGACCGACGGCGUCGA
RS 2 dot .((.((((((((((((((.(((.((((((.(((((((.((…………..)).))))…..))).))).))))))…)))))………..)))))).))))).
RS 3 seq CGAACCGUUACGGGAGAGAUCGGUCGCCCGUGCCAUCAGGCGCGGGGCAGAGCCGGCGCCGAAGGAGCAACCGCCCCCGGAAACUCUCAGGCAAAUGGACCGUAACGGCAUG
RS 3 dot ….((((((((((((((.((((..((…((((.((.(((((.((……)).)))))))..).)))…))..))))…)))))………..)))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table