Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA066969 Similarity: 0.963 Similarity: 0.961 Similarity: 0.960
UTR: 5HSAA066969
Gene: MOSPD2_0
MFE: -41.761
ENS: 0.977
Length: 149.
Predicted Ligands:
FMN - 11/20
SAM - 5/20
cobalamin - 3/20
 RS: URS0000C05B73_1263065
MFE: -48.090
Ligand: SAM
Species: Clostridium clostridioforme CAG:132 SAM riboswitch (S box leader)
 RS: URS0000C1587A_889306
MFE: -40.479
Ligand: SAM
Species: 'Jeotgalibacillus soli' Cunha et al. 2011 SAM riboswitch (S box leader)
 RS: URS0002334AF3_1263071
MFE: -48.827
Ligand: SAM
Species: Coprococcus eutactus CAG:665 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA066969 URS0000C05B73_1263065 URS0000C1587A_889306 URS0002334AF3_1263071
Length 149. 148. 151. 151.
Similarity - 0.963 0.961 0.960
Ensemble Norm 0.977 - - -
MFE -41.761 -48.090 -40.479 -48.827
Ligands - SAM SAM SAM
Gene MOSPD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 2.004 5.
Length SE - 1. 4. 4.
Lev Distance - 46. 46. 46.
UBS 10. 10. 10. 12.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 2.
ILR 4. 5. 4. 5.
H 3. 3. 3. 3.
BL 3. 3. 3. 3.
BR 3. 1. 2. 3.
UN 0.141 0.155 0.205 0.152

Sequences

Field Description
UTR seq + 25 accgccucccccucccacccuucucugucuaccucugggcgggacugccgggugaugagauacucggucggcgacgguagaacgggcgacggcgacaaccgcaaucacauccacgacggugaucATGGCAGAGAATCACGCCCAGAATA
UTR dot + 25 …………((((.(((…………….))).))))(((((((.(((((((…)))).))).)..))))))…(((((……….(((..(((((.((…))..)))))..)))……….)))))……
RS 1 seq CCCUUAUUCAGAGUGAUGGAGGUACAAAGGACCUGUGAAGUCACGGCAACCCCGGUUGAGUAUAUCAGCAAGAUAUGCGAAAGGGCCGGAAGGUGCCAGCCUGAGCGAGGAGUAUGCUGCAAGAGCAUACUUGGUCGAGCAAUAAGAG
RS 1 dot …………((((((.((((…….)))).)…)))))(((.(((((((((..(((((((…..)))))))…..))))))..))))))….((..(((.(((((((((…..)))))))))..)))..))…….
RS 2 seq UUCUUAUUAAGAGAGGUGGAGGGACAAGGCCCUGCGAAACCUCAGCAACCUUCAGUCUUGCCUAUUAUUGUGCAAAUGCUGAAAAGGUGCUAACUCCAGCUUGUCACAGUGAUCUUUAAAAGGAUUAUGAAUACGACAAGGAAGAUAAGAA
RS 2 dot …………((((((.((((……)))).)…)))))(((.(((((((((.(((((…….).))))..)))))..)))))))……..((((((…((((((((….))))))))……))))))………..
RS 3 seq CUCUUAUUCAGAAUGGUGGAGUCAUAAGGGACUGUGAAGCCAUGGCAACCCCGAUGUAAGAUAUCGGAAGGUGCCGACCUGAGCGACGCGGACGCCGGCAAAGCAUAUUUAUAUAUGACUUGCUGAGUGACCUGUGAUCGAACAAUGAGAG
RS 3 dot …………((((((.((((……)))).)…)))))(((.((((((((((…)))))))..))))))….((..((((((((.(((((((((..(((((….)))))..)))))).)))..))))).)))..))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table