Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067066 Similarity: 0.961 Similarity: 0.960 Similarity: 0.960
UTR: 5HSAA067066
Gene: MPHOSPH9
MFE: -30.442
ENS: 0.826
Length: 132.
Predicted Ligands:
TPP - 8/20
FMN - 6/20
cobalamin - 2/20
 RS: URS0000AB7CAB_318586
MFE: -61.
Ligand: TPP
Species: Paracoccus denitrificans PD1222 TPP riboswitch (THI element)
 RS: URS0000C1E23E_3848
MFE: -40.764
Ligand: TPP
Species: Glycine soja TPP riboswitch (THI element)
 RS: URS0000C7DE37_1262877
MFE: -30.349
Ligand: TPP
Species: Eggerthella sp. CAG:368 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067066 URS0000AB7CAB_318586 URS0000C1E23E_3848 URS0000C7DE37_1262877
Length 132. 131. 133. 131.
Similarity - 0.961 0.960 0.960
Ensemble Norm 0.826 - - -
MFE -30.442 -61. -40.764 -30.349
Ligands - TPP TPP TPP
Gene MPHOSPH9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.006 7. 22.012
Length SE - 1. 1. 1.
Lev Distance - 49. 50. 45.
UBS 6. 7. 8. 9.
BS 0. 0. 0. 0.
ILL 2. 4. 3. 2.
ILR 3. 4. 4. 3.
H 3. 3. 3. 3.
BL 0. 0. 0. 2.
BR 0. 0. 1. 3.
UN 0.159 0.084 0.158 0.267

Sequences

Field Description
UTR seq + 25 auauacaggaggagauaaaaaauuuagucaaauuacagacuaguagugcuuccuuagcuuccugugaaggaaauucuucaaacaaacaaguaucuucggaaagucaaATGGAAGAGTTTGACTTGGTGAAAA
UTR dot + 25 …..(((((((((………((((((……..))))))………))…)))))))((((((….))))))…………..((((..(((((((((……)))))))))..))))..
RS 1 seq CCCUCACGUCAGGGGAGUCCCGCCUAGGGGACUGAGAGGCUGACAGGGACCGCCCAUGGGCGGUUCCGGUGAAGCGACCCUUUGAACCUGACCCAGUUGAUGCUGGCGUAGGAAGACCGAAGGGCAGCUUU
RS 1 dot …….(((((…((((((……))))))……))))).(((((((((….)))))))))…(((((..(((((((..((((..(((((….)))))..))))…..)))))))..)))))
RS 2 seq AACAUGCACAAGGGAUGCCUGAAUAUGCACGAGCUCUAGCUAUUAAGCUAGGAUGCUAGCAGAUCAGGCUGUGAUAGUCCCUUCGAACCUGAUCAAGGUGAUGCCUGCGCAGAGAGCCUGCAUUUUCCAUGCU
RS 2 dot ………(((((((((((((…(((…((((((((((….)))))))..))).)))..))))))…….)))))))…((((…..))))(((((..((…….))..)))))………
RS 3 seq ACUACAUAUCAGGGGAGCUUUAAGGCCGCGAUUAAAGGUAUUGGGGUCCGAAAGGCUGAGAGGAAGCAUACGCUUCGACCCAUUGAACCUGUAUGGAUAAUGCCAACGAAGGGAGUUCUAUGACGCAGAUU
RS 3 dot ……………((((((..((((.((((…….)))).)).))..))))))…..(((((….)))))…………(((((((((…(.((……)).)..)))))…))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table