Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067069-0 Similarity: 0.982 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA067069-0
Gene: MPI
MFE: -34.491
ENS: 0.774
Length: 86.
Predicted Ligands:
cyclic-di-GMP - 5/20
zmp-ztp - 4/20
GMP - 4/20
 RS: URS0001A0562A_2653173
MFE: -25.005
Ligand: zmp-ztp
Species: Sphingorhabdus sp. 109 pfl
 RS: URS0000C1771F_1139996
MFE: -16.208
Ligand: SAM
Species: Enterococcus saccharolyticus subsp. saccharolyticus ATCC 43076 SMK box translational riboswitch (SAM-III)
 RS: URS0000C47D8D_1609133
MFE: -33.699
Ligand: cobalamin
Species: Streptomyces sp. NRRL S-495 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067069-0 URS0001A0562A_2653173 URS0000C1771F_1139996 URS0000C47D8D_1609133
Length 86. 86. 85. 87.
Similarity - 0.982 0.981 0.981
Ensemble Norm 0.774 - - -
MFE -34.491 -25.005 -16.208 -33.699
Ligands - zmp-ztp SAM cobalamin
Gene MPI - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 6.001 2.005
Length SE - 0. 1. 1.
Lev Distance - 24. 22. 24.
UBS 7. 8. 7. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 0. 2.
ILR 2. 2. 2. 1.
H 2. 2. 2. 2.
BL 2. 3. 3. 2.
BR 2. 2. 3. 3.
UN 0.058 0.105 0.082 0.126

Sequences

Field Description
UTR seq + 25 auacgugcuuaauccuggugcagggggcgagcauggccgcuccgcgaggugagccauuggcATGGGTTCCAACAGCGAAGTGGCGC
UTR dot + 25 …(((((((..((((……))))..)))))))((((((.((((..(.(((((………))))))..).))).))))))..
RS 1 seq GGCCCUGUUCGUGACUGGCGAGAUCAGGAUGGCUUACCAUCGGGGAGCGGACGAAUUUUCAAAAGCCGAUCGCCUGGGCGCCUCUC
RS 1 dot …(((((((((…..)))))..))))..(((…(((..((.((.(((.(…………)))).)).)))))..)))….
RS 2 seq GACCGUUGCAAGUUCCCGAAAGGAUUCAUUUGUGUAGCAAAUGAAGAUGCCUUGUAACCGACAAAUAUUAGGGGGAAUCAUCAUG
RS 2 dot ….((((((((((((…..)))…)))..))))))..((((.(((.((((.(((……….))).)))).))).)))).
RS 3 seq GGAAGUCCGGUGUGAAUCCGGCACGGUCGCGCCACUGUAUGCCGGACCAGGCCACCUCACGCAACGGCGGGGCCCGGCAAGUCAGAC
RS 3 dot ……..(((((((..(((…)))))))))).((((.((((((.((..(((…………)))..)).)))))).).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table