Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067069-1 Similarity: 0.984 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA067069-1
Gene: MPI_0
MFE: -29.504
ENS: 0.957
Length: 86.
Predicted Ligands:
SAM - 7/20
fluoride - 6/20
cyclic-di-GMP - 3/20
 RS: URS0000BE2FF8_380749
MFE: -22.844
Ligand: fluoride
Species: Hydrogenobaculum sp. Y04AAS1 Fluoride riboswitch
 RS: URS0000DADC92_1802106
MFE: -32.832
Ligand: cobalamin
Species: Candidatus Rokubacteria bacterium RIFCSPLOWO2_02_FULL_72_37 Cobalamin riboswitch
 RS: URS0000C1CF71_224911
MFE: -26.727
Ligand: zmp-ztp
Species: Bradyrhizobium japonicum USDA 110 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067069-1 URS0000BE2FF8_380749 URS0000DADC92_1802106 URS0000C1CF71_224911
Length 86. 86. 85. 86.
Similarity - 0.984 0.983 0.982
Ensemble Norm 0.957 - - -
MFE -29.504 -22.844 -32.832 -26.727
Ligands - fluoride cobalamin zmp-ztp
Gene MPI - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 4.002 7.007
Length SE - 0. 1. 0.
Lev Distance - 21. 21. 22.
UBS 5. 4. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 2.
ILR 1. 0. 0. 2.
H 4. 4. 4. 4.
BL 1. 0. 1. 0.
BR 0. 0. 1. 0.
UN 0.186 0.256 0.235 0.105

Sequences

Field Description
UTR seq + 25 gcagagggccgcgggggcugccgggaaaggcauacgugcuuaauccuggugcagggggcgaATGGGTTCCAACAGCGAAGTGGCGC
UTR dot + 25 ……((((…..))))(((((((.(((((….)))))..)))))))….(((((……)))))….((……))..
RS 1 seq CAGGUUUAAGGAGAUGGCGUUCUCCUUGAUGCUCAUAAAAGCAUCAAAACCGCCUCACAUAUAAGGCUAAUAACGCCUACCUGCUC
RS 1 dot ………(((((……)))))((((((((……))))))))….((((……..))))…….((……))..
RS 2 seq UACCUUCCGCGCGUAGCUCGCGCCCGGGAUGCCCACGAGGGCCCAGGGAAGGCGGUCAGAAGCCGCCGCGACCCCGUCACUGUGA
RS 2 dot ………((((…..))))(((.((..((((….)))))).)))..((((((…..))))))..(((…)))…….
RS 3 seq GUCCUAUCGCGCGACUGGCGAGCUAACGUGGAAUCGACCACGGUGAAGCGCGAAGGGUUCCGACGCCGAUCGCCUGGGCAACCAAU
RS 3 dot ……((((…….))))(((..(((((……)))))….)))((((..(((……)))..)))).(((….)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table