Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067069-2 Similarity: 0.982 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA067069-2
Gene: MPI_1
MFE: -30.091
ENS: 0.689
Length: 86.
Predicted Ligands:
SAM - 6/20
glycine - 3/20
cyclic-di-GMP - 3/20
 RS: URS0000C669FC_1515610
MFE: -28.814
Ligand: SAM
Species: Prauserella sp. Am3 SAM riboswitch (S box leader)
 RS: URS0000C5BC88_87541
MFE: -16.555
Ligand: TPP
Species: Aerococcus christensenii TPP riboswitch (THI element)
 RS: URS0000D6611E_12908
MFE: -20.853
Ligand: GMP
Species: unclassified sequences c-di-GMP-I-UAC riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067069-2 URS0000C669FC_1515610 URS0000C5BC88_87541 URS0000D6611E_12908
Length 86. 88. 87. 85.
Similarity - 0.982 0.982 0.982
Ensemble Norm 0.689 - - -
MFE -30.091 -28.814 -16.555 -20.853
Ligands - SAM TPP GMP
Gene MPI - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 4.013 2.005
Length SE - 4. 1. 1.
Lev Distance - 18. 22. 23.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 2.
ILR 2. 2. 1. 2.
H 2. 2. 2. 2.
BL 2. 1. 1. 1.
BR 1. 2. 2. 2.
UN 0.128 0.193 0.241 0.

Sequences

Field Description
UTR seq + 25 aaaggcauacgugcuuaauccuggugcagggggcgagcauggccgcuccgcgagagagggcATGGGTTCCAACAGCGAAGTGGCGC
UTR dot + 25 ………(((((((..((((……))))..)))))))((((((.(((….(.((((….)))))….))).))))))..
RS 1 seq AUUCCAUCCCGAGCGACCGAGAGACCUGGCUCGUCGACGUCGCAGCAACCUCCCUCGAGGACGGUGCUAACGCCAGGAGCGAUGGAGG
RS 1 dot …………(((((((((((……))).)))..)))))…..(((((.(((…..((((….))))…..))).)))))
RS 2 seq ACUUGAGAUUCGGGGUGCCUUAUGGCUGAGAGUAUACCCGUGGAACCUGAUCAAUCCAGUUGCGGAGGGAAAUCUAGAAAAAGUGAU
RS 2 dot ……….((((((((((((….)))).)))).))))((((.(((……(((……))))))…))))………..
RS 3 seq UCUGAAAAGUGCAAAACCAUCAAAAGGUGGUGACGCAAAAUCUCCGGUCUAAAGGAAUUUUCUUAUGACAGCGAGAUUGCCAUAA
RS 3 dot ………(((…((((((….))))))…))).(((((((.(((..(((((…)))))..))).).))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table