Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067408 Similarity: 0.953 Similarity: 0.953 Similarity: 0.951
UTR: 5HSAA067408
Gene: MRPL22_0
MFE: -48.328
ENS: 0.890
Length: 185.
Predicted Ligands:
cobalamin - 11/20
lysine - 4/20
FMN - 3/20
 RS: URS0000C11BD7_1715004
MFE: -48.083
Ligand: FMN
Species: Clostridiales bacterium KLE1615 FMN riboswitch (RFN element)
 RS: URS0000D8B120_1897044
MFE: -47.898
Ligand: FMN
Species: Clostridiales bacterium 41_21_two_genomes FMN riboswitch (RFN element)
 RS: URS0002317491_1354301
MFE: -37.866
Ligand: cobalamin
Species: Clostridium sp. BL8 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067408 URS0000C11BD7_1715004 URS0000D8B120_1897044 URS0002317491_1354301
Length 185. 185. 185. 184.
Similarity - 0.953 0.953 0.951
Ensemble Norm 0.890 - - -
MFE -48.328 -48.083 -47.898 -37.866
Ligands - FMN FMN cobalamin
Gene MRPL22 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 10.001 8.002
Length SE - 0. 0. 1.
Lev Distance - 59. 59. 61.
UBS 11. 12. 12. 10.
BS 0. 0. 0. 0.
ILL 1. 3. 3. 1.
ILR 2. 4. 4. 1.
H 5. 5. 5. 6.
BL 4. 4. 4. 3.
BR 3. 2. 2. 1.
UN 0.146 0.178 0.178 0.185

Sequences

Field Description
UTR seq + 25 gcuugaacucggcggcuuccguagcgggagggcgaaagauggcggcggcaguacugggacaguugggugcguuauggauacauaaccugaggagccgggggaagcuggccuuggggaaaucuaccacugucgaagacaaauaaaauauagcaaagacaagATGTGGTATTTGGCAAAATTGATAC
UTR dot + 25 (((………((.(((((……))))).))………)))….(((((.((….)).))))).(((((….)))))(((.(((.(((((……)))))))).)))…..((((((((((…………………..))))….))))))……………..
RS 1 seq AAUAUUCUUUGGGGCGGGGUGUAAAUCCCCACUGGCGGUAAAGUCCGCGACCCGCAUUUUUGCGGUUGAUUCGGUGAGUGCAAAGAUAGUGAUGAACAAUUCUUCACAACUCCGAAACCAACAGUAAAGUGAUGCAGCAUUAUUAGCAAAAGCUGUGUCCAAAGUCUGGAUGGGAAAAGAAAGAG
RS 1 dot …………((.((((…….)))).)).((((……))))…(((((….)))))….(((((.(.(((..((((..((…..))…)))))))..).))))).(((.(((……((((((((………….))))))))……)))..)))…………
RS 2 seq AAUAUUCUUUGGGGCGGGGUGUAAAUCCCCACUGGCGGUAAAGUCCGCGACCCGCAUUUUUGCGGCUGAUUCGGUGAGUGCAAAGAUAGUGAUGAACAAUUCUUCACAACUCCGAAACCAACAGUAAAGUGAUGCAGCAUUAUUAGCAAAAGCUGUGUCCAAAGUCUGGAUGGGAAAAGAAAGAG
RS 2 dot …………((.((((…….)))).)).((((……))))…(((((….)))))….(((((.(.(((..((((..((…..))…)))))))..).))))).(((.(((……((((((((………….))))))))……)))..)))…………
RS 3 seq AACUAAAUAUUUGAUUUAGGUGCUUUAGAAGGAAAAAUUCUAAAGUGAAAAGGGAAUGUGGUUAAAAUCCACAGCAGCCCCCGCUACUGUAAAUGAGGACGAACCUUGUAUACCACUCAUAUGAGGAAGGUAAGGUGUAGAAAGAUUCAUGAGCCAGGAGACCUGCCUAAAUUUAUAAAACAAG
RS 3 dot ..((((((…..))))))..(((((((((…….)))))))))…..(((..(((((…….)))))….)))……..(((.((((((…..)))))).)))(.(((….)))).((((.((((……………………))))))))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table