Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067424 Similarity: 0.984 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA067424
Gene: MRPL28
MFE: -17.708
ENS: 0.892
Length: 74.
Predicted Ligands:
fluoride - 15/20
SAM - 3/20
cobalamin - 2/20
 RS: URS000231B6D6_408172
MFE: -12.836
Ligand: cobalamin
Species: marine metagenome AdoCbl variant RNA
 RS: URS0000BFEDE1_69222
MFE: -23.132
Ligand: fluoride
Species: Erwinia mallotivora Fluoride riboswitch
 RS: URS0000BED64F_883113
MFE: -11.821
Ligand: fluoride
Species: Facklamia languida CCUG 37842 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067424 URS000231B6D6_408172 URS0000BFEDE1_69222 URS0000BED64F_883113
Length 74. 75. 73. 74.
Similarity - 0.984 0.984 0.983
Ensemble Norm 0.892 - - -
MFE -17.708 -12.836 -23.132 -11.821
Ligands - cobalamin fluoride fluoride
Gene MRPL28 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.008 2.018 6.097
Length SE - 1. 1. 0.
Lev Distance - 19. 20. 21.
UBS 6. 5. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 0. 1. 0. 0.
H 3. 2. 3. 2.
BL 2. 2. 2. 2.
BR 2. 2. 2. 2.
UN 0.162 0.253 0.027 0.473

Sequences

Field Description
UTR seq + 25 gcagaucggcuuccgguuccggugggcucugaacccugaaaggcucgcgATGCCTCTACACAAGTATCCCGTGT
UTR dot + 25 .((((..(.((.(((….))).)).)))))………((((…….))))..((((………))))
RS 1 seq CAUUUGAAGUAGGGAAAAUUCUGUAAAUUCAGAUACUACACCCGUAACGGUUAAAAGUCCGAACGCCUACAAGAA
RS 1 dot .(((((((.((.(((….))).))..)))))))……..(((..(((……..))).)))……….
RS 2 seq GUUGCGCAAGGUGAUGGUGUUCCACCUUUCCCAACCGCCCCGCCUGGCCGGGGCUGAUGACGCCUGAUAUCGC
RS 2 dot ((((.(.((((((………)))))).).)))).((((((……))))))(((((……..))))).
RS 3 seq UGAAACCAAGGAAAUGAAGUGCUUCCUUUCGUUGACGAUAAACCGCCGUGUUGGCUGAUGACUUCUGUAGGCUU
RS 3 dot ……(((.((((.(((….))).)))).)))……….(((…..)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table