Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067428 Similarity: 0.989 Similarity: 0.988 Similarity: 0.986
UTR: 5HSAA067428
Gene: MRPL28_0
MFE: -16.079
ENS: 0.843
Length: 56.
Predicted Ligands:
glutamine - 11/20
unknown - 7/20
cobalamin - 1/20
 RS: URS0000E601C3_1437824
MFE: -22.249
Ligand: unknown
Species: Castellaniella defragrans 65Phen nhaA-I RNA
 RS: URS0000E5FA56_13249
MFE: -17.471
Ligand: unknown
Species: Rhodnius prolixus nhaA-I RNA
 RS: URS0000D94B0E_1797962
MFE: -16.837
Ligand: cobalamin
Species: Elusimicrobia bacterium RIFOXYA2_FULL_58_8 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067428 URS0000E601C3_1437824 URS0000E5FA56_13249 URS0000D94B0E_1797962
Length 56. 56. 56. 55.
Similarity - 0.989 0.988 0.986
Ensemble Norm 0.843 - - -
MFE -16.079 -22.249 -17.471 -16.837
Ligands - unknown unknown cobalamin
Gene MRPL28 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.001 3.016 5.001
Length SE - 0. 0. 1.
Lev Distance - 15. 15. 16.
UBS 4. 4. 5. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 2.
ILR 2. 2. 2. 2.
H 2. 2. 2. 2.
BL 0. 0. 1. 0.
BR 0. 0. 1. 0.
UN 0.036 0.071 0.161 0.073

Sequences

Field Description
UTR seq + 25 acccugaaaggugggcgcgggcaggcucgcgATGCCTCTACACAAGTATCCCGTGT
UTR dot + 25 .(((……..)))(((((((((((…….))))……..)…)))))).
RS 1 seq GGGUGUUAGCCGCAUCGUGCGGCGGGACAGGACAACGCGCAGGUCGGGCCGCCGCG
RS 1 dot .(((((…..)))))..((((((((((..(……..)..)))…))))))).
RS 2 seq GGGUGUUAGCCACAUGUUGUGGUGGGACAGGUUUGUGCGUUGGUCGGGCCGCCACG
RS 2 dot .(((….)))…….(((((((((((.((….)).)..)))…))))))).
RS 3 seq CGGAGUGAGAAUCUCCGGCUGCCCCGCAACGGUAAUGCCGCAAGGCUAAGCCCGG
RS 3 dot .((((…….))))(((((((..((…(((…)))))..)))..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table