Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067456 Similarity: 0.977 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA067456
Gene: MRPL36
MFE: -25.410
ENS: 0.964
Length: 88.
Predicted Ligands:
TPP - 9/20
glycine - 7/20
fluoride - 2/20
 RS: URS0000C14B51_1736540
MFE: -31.223
Ligand: glycine
Species: Aeromicrobium sp. Root472D3 Glycine riboswitch
 RS: URS0000DB696B_134962
MFE: -36.062
Ligand: fluoride
Species: Nocardia soli Fluoride riboswitch
 RS: URS0000D7DFB3_1415166
MFE: -39.349
Ligand: fluoride
Species: Nocardia nova SH22a Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067456 URS0000C14B51_1736540 URS0000DB696B_134962 URS0000D7DFB3_1415166
Length 88. 89. 88. 89.
Similarity - 0.977 0.976 0.976
Ensemble Norm 0.964 - - -
MFE -25.410 -31.223 -36.062 -39.349
Ligands - glycine fluoride fluoride
Gene MRPL36 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.010 15.003 18.001
Length SE - 1. 0. 1.
Lev Distance - 26. 27. 25.
UBS 6. 7. 6. 7.
BS 2. 0. 0. 0.
ILL 1. 2. 0. 1.
ILR 1. 1. 1. 1.
H 3. 3. 3. 3.
BL 1. 2. 2. 3.
BR 4. 2. 1. 1.
UN 0.080 0.180 0.136 0.045

Sequences

Field Description
UTR seq + 25 gugccagugcgcagacgcaggggucggcgccgggugagagcgugcggccggauucaccacaacATGGCAAATCTTTTTATAAGGAAAA
UTR dot + 25 .(((((((((((.(((……))).)))).(((((((..((……))..)))))).).)).)))))..(((((….)))))…
RS 1 seq CGAUCGCGCGUGGGAGAGCUCGCCCAGGCGACGCCGAAGGGGCAAUUCCUCCCCGGAACCUCUCAGGCACCAAGGACCACGCGUUCGAG
RS 1 dot ……(((.((((.(….).)))).)))..(((..(((((…((((…..)))))))))..)))…..((((…..))))…
RS 2 seq CUCUUCCGUGGCGAUGGAUCUCCGCCGAGGCAGCCCCGUGGGAGUGUCUGAACCGCCCCGGACCGGGGCUGAUGGUUCCUUCCCUCGC
RS 2 dot …..((.(((((………))))).))((((((((((((.(((…….)))))))…))))))))..((……))…..
RS 3 seq CGGCGGUCAGGCGAUGAAGCUCCGCCUGACCGGUGCCUCCGGACACCGGUGCCCCCGUGCCGAACGGCACUGAUGGCUUCUACCCACAG
RS 3 dot …((((((((((………))))))))))(((((..(((.(((.((….)).))))))…)))))((.(((…….))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table